ID: 1045791526

View in Genome Browser
Species Human (GRCh38)
Location 8:105989611-105989633
Sequence GCTCCTTGTGGGAGGCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045791520_1045791526 14 Left 1045791520 8:105989574-105989596 CCAGCTAAATTAGGCTGTTTTGC No data
Right 1045791526 8:105989611-105989633 GCTCCTTGTGGGAGGCAGTGGGG No data
1045791519_1045791526 15 Left 1045791519 8:105989573-105989595 CCCAGCTAAATTAGGCTGTTTTG No data
Right 1045791526 8:105989611-105989633 GCTCCTTGTGGGAGGCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045791526 Original CRISPR GCTCCTTGTGGGAGGCAGTG GGG Intergenic
No off target data available for this crispr