ID: 1045792799

View in Genome Browser
Species Human (GRCh38)
Location 8:106004680-106004702
Sequence GTTTCCTACATATTAACTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045792796_1045792799 22 Left 1045792796 8:106004635-106004657 CCTTGAAAAAATGCAGCTCCTTA No data
Right 1045792799 8:106004680-106004702 GTTTCCTACATATTAACTAATGG No data
1045792798_1045792799 4 Left 1045792798 8:106004653-106004675 CCTTATTTTATGGAATTTAATTG No data
Right 1045792799 8:106004680-106004702 GTTTCCTACATATTAACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045792799 Original CRISPR GTTTCCTACATATTAACTAA TGG Intergenic
No off target data available for this crispr