ID: 1045793378

View in Genome Browser
Species Human (GRCh38)
Location 8:106013064-106013086
Sequence CTAGATTTCCACATCTAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045793378_1045793379 10 Left 1045793378 8:106013064-106013086 CCTAACTAGATGTGGAAATCTAG No data
Right 1045793379 8:106013097-106013119 ATTAGAACTACCGACCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045793378 Original CRISPR CTAGATTTCCACATCTAGTT AGG (reversed) Intergenic
No off target data available for this crispr