ID: 1045794864

View in Genome Browser
Species Human (GRCh38)
Location 8:106030760-106030782
Sequence GGGTGGAAAAAGATCAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045794864_1045794871 30 Left 1045794864 8:106030760-106030782 CCTATCTTGATCTTTTTCCACCC No data
Right 1045794871 8:106030813-106030835 CTCCCTTACTCCAATCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045794864 Original CRISPR GGGTGGAAAAAGATCAAGAT AGG (reversed) Intergenic
No off target data available for this crispr