ID: 1045799970

View in Genome Browser
Species Human (GRCh38)
Location 8:106090707-106090729
Sequence TATATGCTATGTTAGATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045799966_1045799970 20 Left 1045799966 8:106090664-106090686 CCCTGGGAGGCTGACATCACCAC No data
Right 1045799970 8:106090707-106090729 TATATGCTATGTTAGATTTAAGG No data
1045799968_1045799970 1 Left 1045799968 8:106090683-106090705 CCACAGAACTAGCAGTCACCATA No data
Right 1045799970 8:106090707-106090729 TATATGCTATGTTAGATTTAAGG No data
1045799967_1045799970 19 Left 1045799967 8:106090665-106090687 CCTGGGAGGCTGACATCACCACA No data
Right 1045799970 8:106090707-106090729 TATATGCTATGTTAGATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045799970 Original CRISPR TATATGCTATGTTAGATTTA AGG Intergenic
No off target data available for this crispr