ID: 1045800698

View in Genome Browser
Species Human (GRCh38)
Location 8:106097363-106097385
Sequence AGGGCCAAGGGCTCTTTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045800698_1045800708 25 Left 1045800698 8:106097363-106097385 CCAACTAAAGAGCCCTTGGCCCT No data
Right 1045800708 8:106097411-106097433 CTGTAGTCACCTCAGGCCTGGGG No data
1045800698_1045800703 2 Left 1045800698 8:106097363-106097385 CCAACTAAAGAGCCCTTGGCCCT No data
Right 1045800703 8:106097388-106097410 AGTGAACATCATGAGTAGCCAGG No data
1045800698_1045800704 18 Left 1045800698 8:106097363-106097385 CCAACTAAAGAGCCCTTGGCCCT No data
Right 1045800704 8:106097404-106097426 AGCCAGGCTGTAGTCACCTCAGG No data
1045800698_1045800707 24 Left 1045800698 8:106097363-106097385 CCAACTAAAGAGCCCTTGGCCCT No data
Right 1045800707 8:106097410-106097432 GCTGTAGTCACCTCAGGCCTGGG No data
1045800698_1045800706 23 Left 1045800698 8:106097363-106097385 CCAACTAAAGAGCCCTTGGCCCT No data
Right 1045800706 8:106097409-106097431 GGCTGTAGTCACCTCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045800698 Original CRISPR AGGGCCAAGGGCTCTTTAGT TGG (reversed) Intergenic
No off target data available for this crispr