ID: 1045803820

View in Genome Browser
Species Human (GRCh38)
Location 8:106133303-106133325
Sequence TTCACCAGAAGCCGAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045803815_1045803820 13 Left 1045803815 8:106133267-106133289 CCTTTTCCACCATGTTGTGATGC No data
Right 1045803820 8:106133303-106133325 TTCACCAGAAGCCGAGCAGAAGG No data
1045803814_1045803820 21 Left 1045803814 8:106133259-106133281 CCTTTTGACCTTTTCCACCATGT No data
Right 1045803820 8:106133303-106133325 TTCACCAGAAGCCGAGCAGAAGG No data
1045803817_1045803820 7 Left 1045803817 8:106133273-106133295 CCACCATGTTGTGATGCGGCACG No data
Right 1045803820 8:106133303-106133325 TTCACCAGAAGCCGAGCAGAAGG No data
1045803818_1045803820 4 Left 1045803818 8:106133276-106133298 CCATGTTGTGATGCGGCACGAAA No data
Right 1045803820 8:106133303-106133325 TTCACCAGAAGCCGAGCAGAAGG No data
1045803813_1045803820 29 Left 1045803813 8:106133251-106133273 CCTGCTTTCCTTTTGACCTTTTC No data
Right 1045803820 8:106133303-106133325 TTCACCAGAAGCCGAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045803820 Original CRISPR TTCACCAGAAGCCGAGCAGA AGG Intergenic