ID: 1045810617

View in Genome Browser
Species Human (GRCh38)
Location 8:106216088-106216110
Sequence GGTTTAAGGAAACGGCGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045810617_1045810619 -10 Left 1045810617 8:106216088-106216110 CCAAGGCGCCGTTTCCTTAAACC No data
Right 1045810619 8:106216101-106216123 TCCTTAAACCTGTTTGTTTTTGG No data
1045810617_1045810627 18 Left 1045810617 8:106216088-106216110 CCAAGGCGCCGTTTCCTTAAACC No data
Right 1045810627 8:106216129-106216151 TCATGAGGCCCCTCCCTCCTGGG No data
1045810617_1045810623 3 Left 1045810617 8:106216088-106216110 CCAAGGCGCCGTTTCCTTAAACC No data
Right 1045810623 8:106216114-106216136 TTGTTTTTGGGACCCTCATGAGG No data
1045810617_1045810626 17 Left 1045810617 8:106216088-106216110 CCAAGGCGCCGTTTCCTTAAACC No data
Right 1045810626 8:106216128-106216150 CTCATGAGGCCCCTCCCTCCTGG No data
1045810617_1045810621 -9 Left 1045810617 8:106216088-106216110 CCAAGGCGCCGTTTCCTTAAACC No data
Right 1045810621 8:106216102-106216124 CCTTAAACCTGTTTGTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045810617 Original CRISPR GGTTTAAGGAAACGGCGCCT TGG (reversed) Intergenic
No off target data available for this crispr