ID: 1045815842

View in Genome Browser
Species Human (GRCh38)
Location 8:106274910-106274932
Sequence CTGGTTCAAACCATATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045815842_1045815844 30 Left 1045815842 8:106274910-106274932 CCAATAAATATGGTTTGAACCAG 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1045815844 8:106274963-106274985 TTTGTAAACTCAGCAGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045815842 Original CRISPR CTGGTTCAAACCATATTTAT TGG (reversed) Intronic
904430961 1:30463762-30463784 CTGGTTCAAAACATAGCTTTTGG + Intergenic
904513159 1:31031303-31031325 CTGGTTGAAACTGTATTTGTAGG - Intronic
905072848 1:35242690-35242712 CAGGTCCCACCCATATTTATGGG - Intergenic
908431497 1:64063056-64063078 CTGGGTCTAACCATATCTTTGGG - Intronic
912256782 1:108067876-108067898 CTGCTTCAAATCTTAGTTATTGG + Intergenic
915775117 1:158474602-158474624 CTGATTCATAACATCTTTATTGG - Intergenic
919120966 1:193339740-193339762 CTGGTTCAAATCATCTTACTTGG - Intergenic
919338743 1:196275216-196275238 CTGGTTCGAACAACATATATAGG - Intronic
923018197 1:230143012-230143034 CTGGTTCAAACTGTTTTTAGGGG + Intronic
923622506 1:235589892-235589914 ATGGTTCAGGCCATATTTGTTGG + Intronic
924756866 1:246949242-246949264 CTGGTTCAATCCATTTATGTTGG + Intronic
1065398387 10:25266712-25266734 CTTATTCAAAATATATTTATTGG - Intronic
1066268366 10:33798116-33798138 CTGGAGAAAACAATATTTATTGG - Intergenic
1067196870 10:44127645-44127667 CTGGTAAAAACCTTATTTCTGGG + Intergenic
1071415968 10:85441661-85441683 CTGGTTGAACCCTTATTTCTAGG + Intergenic
1071782252 10:88859477-88859499 CTGGCTCAAAACATAATTTTGGG - Intergenic
1072868523 10:99090376-99090398 TTCGTTCAGAACATATTTATTGG - Intronic
1073579857 10:104655564-104655586 CAGTTCCAAACCATATTAATTGG - Intronic
1074675560 10:115845946-115845968 ATGTTTCAAATCATATTTACAGG - Intronic
1075283343 10:121160584-121160606 CTGGTTCAAATGATTTTTATAGG - Intergenic
1079175855 11:18139756-18139778 ATTTTTCAAACCATATTTATTGG + Intronic
1081676084 11:44970429-44970451 CTGCTTCAAACCAAATTGCTTGG + Intergenic
1085898151 11:80664229-80664251 CTGATTCATAAAATATTTATGGG - Intergenic
1088100399 11:106148160-106148182 TTTGTTCAAAATATATTTATTGG + Intergenic
1091896977 12:4113375-4113397 CTAGGTCAAACCATACTAATGGG - Intergenic
1092656688 12:10692509-10692531 CTGGTTCAAACCAGTTCTTTTGG + Intergenic
1098070052 12:66664009-66664031 CTGGTTTAAACAAAATTAATTGG + Intronic
1099067115 12:77995428-77995450 CTCTTTCAAAACATTTTTATAGG - Intronic
1100168297 12:91943595-91943617 TTGCTTAAAACCATATTAATAGG + Intergenic
1100349717 12:93768662-93768684 ATGTTTTAATCCATATTTATTGG - Intronic
1101384487 12:104244677-104244699 CTTGTTCTAACCTTATTTAGTGG - Intronic
1101803152 12:108040169-108040191 CTCATTCAAAACATATTTATTGG + Intergenic
1102617132 12:114164500-114164522 CTGGCCCCAACAATATTTATTGG - Intergenic
1102822434 12:115919112-115919134 CTTGTTAAAAACACATTTATAGG - Intergenic
1107816265 13:44247262-44247284 TTGGTTCAATAAATATTTATTGG - Intergenic
1110397589 13:75049527-75049549 CAGATCCAAACCATATTTAGAGG + Intergenic
1110556269 13:76863249-76863271 CTGGTCCAAACCATATCAACAGG - Intergenic
1110809690 13:79798142-79798164 CTAGTTCAAAGCACATTTACAGG + Intergenic
1112033947 13:95480594-95480616 CTGGTTCACACCAGAGTTTTAGG - Intronic
1115243845 14:31275063-31275085 CTGATTCAAAGCTTATTTAAAGG + Intergenic
1117187687 14:53258009-53258031 CTAGTTCAAAGCTTATTTAAAGG - Intergenic
1117414483 14:55480984-55481006 CTGTCTCAAAACATATATATAGG - Intergenic
1117858839 14:60067796-60067818 CTGTTTTAAACCAAATTGATAGG - Intergenic
1119571153 14:75673921-75673943 TTGGCTCAAATCATATTTAGAGG - Intronic
1120938771 14:89925116-89925138 CAGGTTTAAACCATCTTTAAAGG - Intronic
1121378567 14:93438310-93438332 CTTATTCAACCAATATTTATTGG + Intronic
1123148219 14:106154666-106154688 CTAGTTCTCACCATATTTTTAGG - Intergenic
1123201323 14:106667116-106667138 CTAGTTCTCACCATATTTTTAGG - Intergenic
1126529435 15:49696466-49696488 CTGGATCAAAACATCTTTAGAGG + Intergenic
1131704461 15:94977566-94977588 CTGTTTCAAACCCTATTCAGAGG + Intergenic
1134445695 16:14329573-14329595 TTGGTACAAACCATACTTTTTGG + Intergenic
1136681987 16:31972967-31972989 CTAGTTCTCACCATATTTTTAGG + Intergenic
1136782294 16:32914469-32914491 CTAGTTCTCACCATATTTTTAGG + Intergenic
1136887492 16:33939382-33939404 CTAGTTCTCACCATATTTTTAGG - Intergenic
1138136605 16:54528899-54528921 CTGGTCCAAACAATGTTTTTTGG - Intergenic
1203084959 16_KI270728v1_random:1178456-1178478 CTAGTTCTCACCATATTTTTAGG + Intergenic
1142780333 17:2176500-2176522 CTGGTTCAATGCATATTTTAGGG + Intronic
1146228701 17:31090018-31090040 CTGGATCAAACCACATTCATGGG + Intergenic
1155970456 18:32078091-32078113 CTGAATCAAAAAATATTTATTGG - Intergenic
1157150605 18:45213662-45213684 CTGGTTTAAATCTTATTGATTGG + Intronic
1157436916 18:47678058-47678080 CACATTCAAACCATATTAATCGG + Intergenic
1159206239 18:65256490-65256512 CTGGGTCAAATGATATTTCTCGG + Intergenic
1164823178 19:31265653-31265675 CAGGTTCAAGCCATATGTTTAGG - Intergenic
925492879 2:4414555-4414577 TTGGTTCAAAGAATATTTAATGG + Intergenic
927062543 2:19437247-19437269 CAGGTTCAAATCAGATTTTTAGG + Intergenic
928972226 2:37041996-37042018 GAGGTTCAAATCATAATTATAGG - Intronic
929939242 2:46319272-46319294 CTGGCTCAAAGCATACATATGGG - Intronic
935426045 2:102919266-102919288 CTGGGGCAAACCATAATTAATGG + Intergenic
935460566 2:103328196-103328218 ATGATTCAAAGCATATTTGTTGG - Intergenic
940054693 2:149501099-149501121 CTGGTTCAGACCTTATTTGCTGG + Intergenic
940188659 2:151014931-151014953 CAGGTTTAAAATATATTTATTGG + Intronic
941443903 2:165576012-165576034 CTGGTCCAAACAATATTTATAGG + Intronic
945313670 2:208346187-208346209 CTTTTTCAAACCATAATTATAGG - Intronic
946129819 2:217597999-217598021 CTACTTCAAACCACATTTCTTGG + Intronic
947064388 2:226205395-226205417 TTTGTTCAGATCATATTTATTGG + Intergenic
1174415335 20:50362576-50362598 CTGGGTCAAACGGTATTTCTAGG + Intergenic
1174881330 20:54282413-54282435 CTTATTCAAGACATATTTATTGG - Intergenic
1175687127 20:61039693-61039715 CTCTTTAAAACCATATTTCTAGG + Intergenic
1176655548 21:9586385-9586407 GGGCTTCAACCCATATTTATTGG + Intergenic
1177020697 21:15853914-15853936 TTGGTTCATTCCATAGTTATTGG + Intronic
1179114880 21:38481463-38481485 CTGGTTAAAACATTATATATAGG - Intronic
1183541993 22:38434777-38434799 CTGGTTAAACCCATATGTTTTGG + Intronic
950823951 3:15795278-15795300 CTGGTGCAAGCTATATTTAACGG - Exonic
952134787 3:30406221-30406243 ATGGTTCAATTAATATTTATTGG - Intergenic
953795499 3:45982698-45982720 CTGCTTCAAACCATGGTTCTTGG - Intronic
955416076 3:58692426-58692448 CTAATTCAAACCTTATTTAAAGG - Intergenic
955775799 3:62431655-62431677 CTGGTTCAAAATAAATTTAAGGG + Intronic
957123222 3:76123819-76123841 CTGCTTCACATCATATTTATGGG + Intronic
962399803 3:135048595-135048617 CTGCTTCAAATCTAATTTATGGG - Intronic
963239393 3:142988155-142988177 CTGGGTTGAACCATATTTAAGGG + Intronic
964511772 3:157460419-157460441 CTCATTCAAAAAATATTTATTGG + Intronic
972952576 4:44346295-44346317 CTCATTCAAAAGATATTTATTGG + Intronic
975146249 4:70970572-70970594 CTGATTCAACCCACATTTTTTGG - Intronic
976257193 4:83110767-83110789 ATGGTCGAAACCATATTTTTGGG + Intronic
976277434 4:83291596-83291618 TAGGTTTAAACAATATTTATTGG + Intergenic
981305642 4:143244347-143244369 TTGGTTCAAACAAAATTTCTAGG + Intergenic
988608812 5:32705744-32705766 CAGATTCAAACCATATCAATGGG + Intronic
990195606 5:53311594-53311616 CTGTTTGCAACCATATTGATAGG + Intergenic
993730726 5:91419403-91419425 CTGATTCAAACCAGCTTTCTAGG - Intergenic
994035177 5:95190928-95190950 TTGCTTCAAACCAAATATATAGG - Intronic
994140565 5:96336274-96336296 CTGGAGTAAAACATATTTATTGG - Intergenic
994416799 5:99482479-99482501 ATGTTTTAAACCACATTTATTGG - Intergenic
994463171 5:100092678-100092700 ATGTTTTAAACCACATTTATTGG + Intergenic
995221855 5:109657051-109657073 CTGGTGCAAGCCACATTTCTGGG - Intergenic
998055276 5:139070707-139070729 CAGGTTCAAAGCATATTTTATGG - Intronic
998324402 5:141266720-141266742 CTGGTACAAAATATATTTTTGGG - Intergenic
1000032430 5:157415208-157415230 CTGGTTCAAAATATATTTCAAGG + Intronic
1002159111 5:177304472-177304494 ATGGTTCAAACCAGAGTTAAGGG - Intronic
1005846710 6:29786414-29786436 CTGCATCAAACCAAAGTTATTGG + Intergenic
1009758452 6:67972597-67972619 CTGTTTCTATCCATATTTAAGGG + Intergenic
1010230915 6:73534396-73534418 ATGTTACAAACCATCTTTATTGG - Intergenic
1010318714 6:74481801-74481823 CTTTTTCAAAGCAGATTTATTGG - Intergenic
1010355282 6:74925487-74925509 CTGGTTTAAATCATATTCATAGG - Intergenic
1014090659 6:117400410-117400432 CTTGTTCAAAATATATTCATGGG - Intronic
1015750517 6:136553867-136553889 CTGTTTCAAACCATCTTTCCAGG + Intergenic
1017105615 6:150884908-150884930 CTGGGTCACTCCAGATTTATAGG + Intronic
1017811016 6:157983438-157983460 CTACTTCATACCACATTTATCGG + Intronic
1020414489 7:7930419-7930441 TTGATTCAAACAATATGTATTGG - Intronic
1020804801 7:12775933-12775955 CTGGTTTAACCCATGATTATGGG + Intergenic
1032971592 7:137170495-137170517 CTTGTTCAACCCATATCTCTTGG - Intergenic
1033345022 7:140519832-140519854 CTGATTCAGAGCATGTTTATAGG - Intronic
1035964234 8:4172650-4172672 CTGGTCCAGCCCATATTTAAGGG - Intronic
1036458178 8:8927870-8927892 CATGTTCAAACCATATTGATGGG - Intergenic
1036801883 8:11798743-11798765 CTGGCTCAATGAATATTTATTGG - Intronic
1039386442 8:37140061-37140083 CTGATACAAACAACATTTATTGG - Intergenic
1039594654 8:38780455-38780477 CGGGTTCAAGCCATCTTTTTTGG + Intronic
1040009626 8:42650516-42650538 CTGGTTCAAACCATGTTCTGTGG - Intergenic
1041251174 8:55936147-55936169 CTGGTTCAAGCATCATTTATAGG - Intronic
1043007262 8:74835066-74835088 ATGTTTCAAATTATATTTATAGG + Intronic
1043800977 8:84609022-84609044 TTGCTTCAAACCAGATTTTTTGG + Intronic
1045815842 8:106274910-106274932 CTGGTTCAAACCATATTTATTGG - Intronic
1047585694 8:126269570-126269592 AGTGTTCAAACCATTTTTATAGG + Intergenic
1050531469 9:6593626-6593648 CTATTTTAAACCATATTTAATGG + Intronic
1051682677 9:19623797-19623819 CTGGTTCCAAGCATTTTTATAGG + Intronic
1052046130 9:23796202-23796224 CTGGTTCAAGCCCTGGTTATGGG + Intronic
1053573237 9:39331520-39331542 CTGTTTCAAAAATTATTTATAGG - Intergenic
1054094808 9:60890226-60890248 CTGTTTCAAAAATTATTTATAGG - Intergenic
1054116274 9:61166130-61166152 CTGTTTCAAAAATTATTTATAGG - Intergenic
1054123907 9:61287491-61287513 CTGTTTCAAAAATTATTTATAGG + Intergenic
1054591485 9:67016414-67016436 CTGTTTCAAAAATTATTTATAGG + Intergenic
1055337291 9:75245933-75245955 CAAGTTCAAACCATATTACTAGG - Intergenic
1055900038 9:81223722-81223744 ATGGTTGGAACCATATTTAAAGG - Intergenic
1057797398 9:98168838-98168860 CTGGTGCAAACCATGATGATGGG + Intronic
1060347761 9:122831590-122831612 CTTGATCCAACCAGATTTATAGG + Intergenic
1061500275 9:130997906-130997928 CTGGATCCAACCATCTTTATAGG + Intergenic
1203633266 Un_KI270750v1:89857-89879 GGGCTTCAACCCATATTTATTGG + Intergenic
1188945107 X:36290927-36290949 CTGATACAAACCATAGTTTTTGG - Intronic
1189026218 X:37397694-37397716 CCAGTTCAAAACATATTTAAGGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1196382446 X:115105770-115105792 ATTGTTCAAATCATATTTCTGGG + Intergenic
1197359880 X:125487871-125487893 CTGATTCTAAACATTTTTATGGG - Intergenic
1198964786 X:142215840-142215862 CAGATTCAAACCATATCAATAGG - Intergenic
1199004534 X:142679798-142679820 CTTGTTCAATATATATTTATGGG - Intergenic
1199296837 X:146169014-146169036 CAGGTCCCACCCATATTTATGGG - Intergenic