ID: 1045816598

View in Genome Browser
Species Human (GRCh38)
Location 8:106283824-106283846
Sequence GTGAAACCTCACAATTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045816597_1045816598 -9 Left 1045816597 8:106283810-106283832 CCTAACTCAGGTCAGTGAAACCT 0: 1
1: 0
2: 0
3: 71
4: 910
Right 1045816598 8:106283824-106283846 GTGAAACCTCACAATTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045816598 Original CRISPR GTGAAACCTCACAATTATTT AGG Intronic
No off target data available for this crispr