ID: 1045819407

View in Genome Browser
Species Human (GRCh38)
Location 8:106318494-106318516
Sequence CTTTGTGAACATAGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045819407 Original CRISPR CTTTGTGAACATAGGAAGCA GGG (reversed) Intronic
903107682 1:21098047-21098069 CTTGGGCAACATAGCAAGCAAGG + Intronic
903999807 1:27332462-27332484 CTTTGGGAACAAATGAGGCATGG + Intronic
904409989 1:30319556-30319578 CTGTGGGGACATAGGAAGCTGGG - Intergenic
905374726 1:37512445-37512467 ATTTGTGAATATAGGTAGGAGGG + Intronic
909868063 1:80700694-80700716 CTTTGGGAACAAAAGAATCAAGG - Intergenic
910248823 1:85172247-85172269 CTCTGTGAAGTTAGGAGGCAAGG + Intronic
910529709 1:88222006-88222028 CCTTGAGAAAATAAGAAGCAGGG + Intergenic
910649692 1:89552725-89552747 CCTGGTGAACACAGGGAGCAGGG - Intronic
912150243 1:106850571-106850593 CTAAGGGAACATAGGAAGAAGGG - Intergenic
915441512 1:155948168-155948190 CTTTGGCAACAAAGTAAGCAAGG + Intronic
915618308 1:157059706-157059728 CTTTGTTAACAAAGGAGGAATGG + Intergenic
916289778 1:163152231-163152253 CTTTGTGAAAATAAGAATAATGG - Intronic
916640277 1:166720741-166720763 CATTGTGAAAAGAGAAAGCATGG - Intergenic
916644172 1:166765756-166765778 TTTTGGCAACATAGGAAGCAAGG + Intergenic
916822553 1:168413761-168413783 CAATGTGATCATAGGAAACAGGG + Intergenic
917312869 1:173695063-173695085 TTTTGTTAACATAGGTAGGAAGG - Intergenic
919848741 1:201658231-201658253 CTTTCAGAACCTAGTAAGCAGGG - Intronic
920035118 1:203060521-203060543 CTTTGTGAGGATGGGAAGGAAGG - Intronic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
921105057 1:211968932-211968954 CTTTGTGAATGTAGGCAGTAAGG - Intronic
1063267834 10:4473984-4474006 CTTTATGCACGTGGGAAGCAAGG + Intergenic
1063331321 10:5162410-5162432 CTCTGTTTACATATGAAGCATGG + Intergenic
1065043616 10:21724243-21724265 CTTTGAGATAATAGAAAGCAAGG + Intronic
1065176642 10:23082510-23082532 CTTTGTTTACATATGAAGTATGG - Intergenic
1066392917 10:34993251-34993273 CTTTGTGGAAATAAGAAACAAGG - Intergenic
1066810695 10:39330244-39330266 CTTTGTCAACATAGGCATCATGG + Intergenic
1069916287 10:71789208-71789230 CTTTGTGCTCATAGGAGGCCCGG - Intronic
1071205573 10:83272354-83272376 CTTTTTGTATATAGCAAGCATGG - Intergenic
1071348656 10:84717224-84717246 TATTGTCAACATAGCAAGCATGG + Intergenic
1072724490 10:97803584-97803606 CTTTCAGGACATAGGATGCACGG + Intergenic
1074472274 10:113738223-113738245 CTTTGTGAATTTAGGAAGTATGG + Intergenic
1075985367 10:126780391-126780413 ATTTGAGAACATTGGAAGAAAGG - Intergenic
1078446671 11:11409871-11409893 CTTTGTTTACATAGATAGCAGGG - Intronic
1078470890 11:11585762-11585784 ATTTGTGAAAATAGAAAACAAGG + Intronic
1079585014 11:22114799-22114821 CTTTGGGGATATAGGAAGGAGGG + Intergenic
1081698808 11:45138805-45138827 TTTTGTGAACATAGTTAGAAAGG - Intronic
1085367732 11:75966983-75967005 CTTTCTGACCAGAGGAACCAGGG - Intronic
1085480287 11:76816538-76816560 CATTGTGAAAAGAGAAAGCATGG + Intergenic
1085766897 11:79291180-79291202 CTCTGTGACCCTAGGATGCACGG + Intronic
1085865613 11:80288144-80288166 CTGTGTGAACTTGGGAACCAGGG + Intergenic
1090015575 11:123083339-123083361 CTTTGGGAACATGAGAAGAAAGG + Intronic
1091685431 12:2558189-2558211 CTTTGAGATCCCAGGAAGCAGGG + Intronic
1092551791 12:9510181-9510203 ATATGTGAACATAGGAAGCTGGG + Intergenic
1093735474 12:22615284-22615306 CATTGTGAAAAGAGAAAGCATGG - Intergenic
1095070191 12:37833182-37833204 CTTTGTCACCATAGGCATCAAGG - Intergenic
1095077844 12:37954207-37954229 CTTTGTCATCATAGGCTGCAAGG + Intergenic
1095077963 12:37956089-37956111 CTTTGTCACCATAGGACTCAAGG + Intergenic
1095245702 12:39918669-39918691 TTTTGTATACATAGAAAGCATGG - Intronic
1095602554 12:44029927-44029949 CATTGTGAAAAGAGAAAGCATGG - Intronic
1097691891 12:62741376-62741398 CTTTGTGACCCTATGAAGCACGG - Intronic
1099048687 12:77756438-77756460 TATTGTGAACATAGGAATGAAGG + Intergenic
1101682568 12:106984005-106984027 CTTTGTACAGATAGGAGGCAAGG - Intronic
1102667459 12:114587608-114587630 CTTTGAGAACAGAGGAAATAGGG + Intergenic
1105723119 13:23135472-23135494 GTTTGTGAACAGAGGAAAAATGG - Intergenic
1106118644 13:26838776-26838798 CTCTGGGAACACAGCAAGCAGGG - Intergenic
1107053103 13:36073762-36073784 CTTTGAGATCATAGGTAGCAAGG - Intronic
1108507994 13:51129941-51129963 CATTGTGAAAAGAGAAAGCAAGG - Intergenic
1109571363 13:64194565-64194587 CTATGAGTACATAGGAATCAAGG + Intergenic
1109741286 13:66559298-66559320 CTTTGTAAGCATAGGAAAGAAGG - Intronic
1109920109 13:69045681-69045703 CTTTGGGAAAATACGAAGGAAGG + Intergenic
1111967880 13:94879416-94879438 CACTGTGAACATAAGCAGCAAGG - Intergenic
1113675106 13:112201821-112201843 CTGTGTGCACATTGGAAGCTGGG + Intergenic
1116090107 14:40293944-40293966 TTTTATGAACACAGGATGCAGGG + Intergenic
1118322064 14:64759169-64759191 CATTGTGTGGATAGGAAGCAGGG - Intronic
1118357750 14:65029160-65029182 CTTTATGTAAATAGAAAGCACGG - Intronic
1118798671 14:69168746-69168768 CTTTCTGTACAGAGGAAGGAAGG - Intergenic
1119617353 14:76107601-76107623 CTTTGTCTACAAAGGGAGCAGGG - Intergenic
1125221807 15:37346185-37346207 CTTTGTGAACATAAACATCAAGG + Intergenic
1125613967 15:40993225-40993247 CTATGTGAACCTTGGAAGCAAGG + Intronic
1131693015 15:94846474-94846496 CTTTGGGGACAGAGGATGCACGG + Intergenic
1132297841 15:100755352-100755374 CTTTGTGAACAAATGGAACAAGG + Intergenic
1132770203 16:1557969-1557991 CTTTGTCACCATAGGAGACATGG - Exonic
1133377254 16:5297935-5297957 CCTTTTAAACATAGAAAGCAAGG + Intergenic
1133388942 16:5393446-5393468 CTTTGTCAACATCACAAGCAAGG - Intergenic
1134851195 16:17480338-17480360 CCTTGTCAACCTGGGAAGCAAGG - Intergenic
1135492015 16:22917490-22917512 CCATGTGTCCATAGGAAGCAAGG + Intergenic
1137319033 16:47359626-47359648 CTTTGTGGACAAAGGTAACAAGG - Intronic
1138160446 16:54748288-54748310 CTTTGGGAACAGAGGAATTATGG - Intergenic
1138243651 16:55449203-55449225 CTTTCTGAAACCAGGAAGCATGG + Intronic
1138886300 16:61083340-61083362 TTTTGTAATCCTAGGAAGCAGGG + Intergenic
1139217582 16:65143550-65143572 CTTTCTAAACCTAAGAAGCAAGG - Intergenic
1139314836 16:66059334-66059356 CTTTGTGTACTTGGGAAGGAAGG - Intergenic
1139494563 16:67306924-67306946 CTTTGAGCACATGGGAAGCTAGG + Intronic
1140774190 16:78235195-78235217 CTGTTTGAAGAAAGGAAGCATGG - Intronic
1142429336 16:90018183-90018205 CTTTGTGGACATAGGAAGCCTGG - Intronic
1142642539 17:1292808-1292830 CTTTGTGATCACACGAAGAAAGG - Intronic
1143525694 17:7470898-7470920 CTTTCTGAAAATTAGAAGCAAGG + Intronic
1145038227 17:19556050-19556072 CATTGTGTACATGGTAAGCAGGG + Exonic
1146127858 17:30243075-30243097 GTTTTTCAACAAAGGAAGCATGG + Intergenic
1146608625 17:34285347-34285369 CCATGTGAACACAGGAATCAAGG + Intergenic
1147522997 17:41192405-41192427 ATTTGGGAACCCAGGAAGCATGG - Intronic
1147782518 17:42953865-42953887 TTATGTGTACATAGGCAGCAAGG - Intronic
1149739970 17:59035789-59035811 CTATGTGAACTTCAGAAGCATGG - Intronic
1151287538 17:73123849-73123871 CATTGTGCCCACAGGAAGCAGGG - Intergenic
1151288861 17:73133971-73133993 CTTAGTAACCCTAGGAAGCAGGG + Intergenic
1156010064 18:32487014-32487036 TTTTGGGAAGAAAGGAAGCAGGG - Intergenic
1156563528 18:38157124-38157146 CTTTCTGAAGAAAGGAGGCAGGG - Intergenic
1156670916 18:39468478-39468500 TTTTGTGAAGATAGGAAGCCAGG + Intergenic
1157304394 18:46506656-46506678 CATTGTGAGAATAGGAAGAAAGG + Intronic
1157990974 18:52495949-52495971 CCTTATAAACATAGAAAGCAGGG - Intronic
1158516370 18:58133837-58133859 CTTTCTGAGCTTAGGAATCATGG + Intronic
1159636292 18:70809072-70809094 CATGGGGATCATAGGAAGCAGGG + Intergenic
1162548803 19:11346835-11346857 CTTAGGGACCATAGGAAGCCTGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164910159 19:32004453-32004475 CTTTTTAAAAATAGTAAGCAAGG - Intergenic
1165988735 19:39793290-39793312 GTTTGTGGACCTAGGAAACAGGG - Intergenic
1168027468 19:53653117-53653139 CGTTGTGAAAAGAGAAAGCAGGG - Intergenic
927559362 2:24059023-24059045 CATATTTAACATAGGAAGCAGGG - Intronic
928856508 2:35808916-35808938 CTGTGTGCAAAGAGGAAGCAGGG - Intergenic
930735980 2:54779235-54779257 CTTTTAGAATATAGGAAGGAGGG + Intronic
932757201 2:74417183-74417205 GTTTGTGAACAAAGGAAAAATGG + Intronic
941639551 2:167972471-167972493 CATTGTGAAAAGAGAAAGCAAGG - Intronic
942060189 2:172222337-172222359 CTTTGGGGACTTGGGAAGCATGG + Intergenic
942865565 2:180670219-180670241 CATTGAGCACATAGGAAGCGAGG + Intergenic
943013378 2:182479866-182479888 CTTTATGTACATAGGAAGAAAGG + Intronic
946539954 2:220673330-220673352 TTTTGAGAACATGGGAGGCAAGG - Intergenic
1169691957 20:8342026-8342048 CTTTGTGCCCCTAGAAAGCATGG - Intronic
1169733499 20:8812124-8812146 CTTTGGGTATATAGCAAGCAAGG - Intronic
1174124328 20:48291673-48291695 CTTATTGAACATAGAAAGCTGGG - Intergenic
1178201792 21:30415233-30415255 CATTGTGAAAAGAGAAAGCATGG - Intronic
1178621468 21:34180772-34180794 CTTTGTGAACAAATGAGACAAGG + Intergenic
1178791450 21:35704173-35704195 CTGTGTGAACACAAGAAGGAAGG - Intronic
1180707839 22:17820173-17820195 CTTTGGGATTCTAGGAAGCATGG - Intronic
1182732881 22:32509521-32509543 GTGTATGAACATAGGAACCAAGG - Intergenic
1182974169 22:34606964-34606986 CTTTTTCAACTTAAGAAGCAAGG - Intergenic
949397101 3:3626306-3626328 CATTGTGAACAGAGAAAGTAAGG - Intergenic
951081602 3:18456390-18456412 CTGTGTGAACTGAGGAGGCAGGG - Intergenic
951161033 3:19422754-19422776 CTTTGTGAACATAGGGATTATGG - Intronic
952894675 3:38070251-38070273 CTTTGTGTCCATGGGAAGAATGG + Intronic
953416239 3:42719731-42719753 CATTGTGAAAAGAGAAAGCATGG - Intronic
953523603 3:43667599-43667621 CTTTGGGAACTTAGGGTGCAGGG - Intronic
959951777 3:112187016-112187038 CCTTTTGAACTTAGAAAGCAGGG - Intronic
960270895 3:115673363-115673385 CTTTATGAACATAAGGAGTAGGG - Intronic
961510766 3:127401987-127402009 CATTGTGAAAAGAGAAAGCATGG + Intergenic
961974660 3:131010560-131010582 CTCTCTGAACATAGGAAAAAGGG + Intronic
967836549 3:193969093-193969115 CTGAGTGAACTTAGGAAGGAGGG + Intergenic
969345009 4:6564620-6564642 CTTTGTGCACATTGGCATCACGG - Intergenic
969419995 4:7088142-7088164 CTTTGTATAGCTAGGAAGCATGG + Intergenic
969634658 4:8360124-8360146 CATTGTGAAAAGAGAAAGCATGG - Intergenic
970015770 4:11510870-11510892 CTTTGAGCAAATAGGAACCATGG + Intergenic
971017404 4:22502590-22502612 CTTTTTTAACAGAGGAAGAAAGG + Intronic
972783019 4:42302195-42302217 ATTTGTGGACATGGGAACCAAGG - Intergenic
973826595 4:54713267-54713289 CTTTGGGGACCTAGGAAGAAGGG - Intronic
975329799 4:73100070-73100092 GTTTGTGAACAGAGGAAAAATGG - Intronic
976039806 4:80869880-80869902 ATGAGTGACCATAGGAAGCAGGG - Intronic
980778511 4:137466150-137466172 CATTGTGAAAAGAGAAAGCATGG - Intergenic
982044704 4:151432429-151432451 AGTTGTGAACAAAGCAAGCAAGG + Intronic
984148082 4:176089824-176089846 CTTTCTGACCCTAGGAACCAGGG - Intronic
985833187 5:2251133-2251155 TTTTCTGAACTTAGGAAGAAAGG - Intergenic
985952816 5:3236460-3236482 CTCTTTGAACAGAGGAGGCAAGG - Intergenic
987112180 5:14698745-14698767 CATTGTGAGCAGAGGAATCAAGG + Exonic
993939502 5:94041375-94041397 CATTGTGAAAAGAGAAAGCACGG - Intronic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
994935183 5:106245615-106245637 CTATGGGAAAATAGAAAGCATGG + Intergenic
996376119 5:122809488-122809510 CTTTGTCAGCATAGCAAGGAAGG - Intronic
998280799 5:140805540-140805562 CTTTATGGATATAGGAGGCAAGG + Intronic
999371716 5:151059491-151059513 CTTTGTGAAGGGAGGCAGCAGGG + Intronic
1000043946 5:157506004-157506026 CTTTGAGAACTCAGGAAACATGG - Intronic
1001888188 5:175315168-175315190 CTTTTGCAACTTAGGAAGCAAGG - Intergenic
1002168295 5:177361472-177361494 CTTTGTGGACCAAGGAAGCTTGG - Intronic
1002349300 5:178571726-178571748 CTTTCTGCACATAGGCAGTACGG - Intronic
1002772374 6:300984-301006 CTTTGGCAACAGAGGCAGCAGGG - Intronic
1003314343 6:4998111-4998133 CTTTTGGAGGATAGGAAGCATGG - Intronic
1004296588 6:14417373-14417395 GTTTGTGAACATAAGATGAAGGG + Intergenic
1004538827 6:16529221-16529243 TTTTGTGAAGATAGCAAGCGAGG + Intronic
1005095333 6:22108753-22108775 CTTAGTAACCATTGGAAGCATGG + Intergenic
1005500272 6:26423141-26423163 CTTTGTGAGCAAAGACAGCAGGG + Intergenic
1006474548 6:34245822-34245844 GTTTGTGAACAGAGGAAAAATGG - Exonic
1007895332 6:45350460-45350482 CTATTTCAACAAAGGAAGCAGGG + Intronic
1008808490 6:55462324-55462346 CATGGTGAGCATAGGAAGGAAGG - Intronic
1009681761 6:66902675-66902697 CTGTATGACCATAGGCAGCACGG - Intergenic
1010010987 6:71048024-71048046 CTTTGAGAAATTATGAAGCAGGG + Intergenic
1010927197 6:81757012-81757034 TTTTGAGAAGGTAGGAAGCAGGG - Intergenic
1012383144 6:98644305-98644327 CTTTGTGAACAAGGGAGGAAAGG - Intergenic
1012812150 6:103972593-103972615 ATTTGGGAAAATAGGAGGCAAGG + Intergenic
1013591659 6:111623833-111623855 CTTTGGGCAAATAGGAAGAATGG - Intergenic
1014111627 6:117624111-117624133 CATTGTGAAAAGAGAAAGCACGG - Intergenic
1015600018 6:134902738-134902760 CTTTGGGAACATCAGATGCAGGG + Intergenic
1016321568 6:142852133-142852155 CTTTTTAAAGATAGAAAGCATGG - Intronic
1017869468 6:158474555-158474577 CTTTTTGAAGAGAGGGAGCAGGG - Intronic
1017987000 6:159452768-159452790 CTTTGTGTTCAAAGGAAGCAGGG + Intergenic
1018066406 6:160127599-160127621 GTTTGGGAGCAGAGGAAGCATGG + Intronic
1018357467 6:163033730-163033752 CATTGTGAAAAGAGAAAGCATGG + Intronic
1021495885 7:21274263-21274285 CTTTGTGAGCACAGGGACCACGG - Intergenic
1022253261 7:28629695-28629717 CATTGGGAACATATGAATCATGG - Intronic
1027952476 7:84835252-84835274 CTTGGAGAAGATAGGAATCAAGG - Intergenic
1028389064 7:90294547-90294569 CATTGTGAAAAGAGAAAGCATGG + Intronic
1029493960 7:100887292-100887314 GTTTGGGAACAGAGGAAGGAAGG - Intronic
1031095091 7:117407722-117407744 CTATGTGAAGAGATGAAGCAGGG + Intronic
1031181853 7:118429432-118429454 CTCTTTGAACATAGGAAGCTTGG - Intergenic
1032139104 7:129310321-129310343 CTTGGTGATCTTAGCAAGCATGG - Intronic
1033161744 7:139002900-139002922 CATTGTGAAAAGAGAAAGCATGG - Intergenic
1037336242 8:17795124-17795146 CTTTTTGTACATTGGAAACATGG - Intronic
1038840203 8:31177716-31177738 CTTTGTGAAGAATGGGAGCACGG + Intergenic
1040471135 8:47736890-47736912 CACTGCGAATATAGGAAGCAGGG + Exonic
1044023158 8:87132185-87132207 TTTTTTTAACATATGAAGCAAGG - Intronic
1044439610 8:92208209-92208231 CATTGTGAAAAGAGAAAGCATGG + Intergenic
1045428246 8:102088196-102088218 CATTGTGAAAAGAGAAAGCATGG - Intronic
1045819407 8:106318494-106318516 CTTTGTGAACATAGGAAGCAGGG - Intronic
1045871332 8:106930442-106930464 CTTTGTGAACTTAGGATACTTGG + Intergenic
1046227299 8:111300047-111300069 ATTTGTGAATATAGGAAAAAGGG + Intergenic
1047876904 8:129148642-129148664 GTGTGGGAAAATAGGAAGCAGGG - Intergenic
1047958956 8:129997032-129997054 CTTTGTGAAGGAAGGAAGGAAGG + Intronic
1048436442 8:134423001-134423023 CTCTGTGGACATAGGATCCAAGG - Intergenic
1050401636 9:5262284-5262306 CATTGTGAAAAGAGAAAGCATGG + Intergenic
1052472728 9:28920401-28920423 TTTTGTGAACAAAGGATACAAGG - Intergenic
1053873055 9:42513843-42513865 TTTTGTGAAGAGAGGAAGCAGGG + Intergenic
1053899697 9:42782077-42782099 TTTTGTGAAGAGAGGAAGCAGGG - Intergenic
1054261948 9:62875516-62875538 TTTTGTGAAGAGAGGAAGCAGGG + Intergenic
1054269275 9:62952909-62952931 TTTTGTGAAGAGAGGAAGCAGGG - Intergenic
1054840417 9:69732285-69732307 CTTTGTGACCAAAGGAAACTTGG - Exonic
1055625896 9:78177335-78177357 CTTTGTGAGCTTTGGTAGCAGGG + Intergenic
1055638513 9:78300440-78300462 CTTTGTGGACATGGGAAGGAAGG + Intronic
1056150061 9:83776993-83777015 CTGTGTGAAGAAAGGAACCAGGG - Intronic
1060678066 9:125534876-125534898 CTGGGTGCACATGGGAAGCAGGG - Intronic
1061291725 9:129654163-129654185 CTTTTTGGAAATAGGAGGCAGGG - Intergenic
1185625530 X:1478789-1478811 TTATGTGAACATAGATAGCAGGG + Intronic
1186363965 X:8872496-8872518 CTTTGTGAAGAGAGGCAGAAGGG + Intergenic
1186673255 X:11788658-11788680 GCTTTTGAACATAGGAACCAAGG - Intergenic
1188133869 X:26470634-26470656 CATTGTGAAAAGAGAAAGCATGG + Intergenic
1190382285 X:49851585-49851607 CTTAGTGTAAATAGGATGCAGGG - Intergenic
1190947515 X:55110068-55110090 CATTGTGAAAAGAGAAAGCATGG - Intronic
1191119465 X:56888442-56888464 CTTTGTGAAAAGAGAAAGCATGG - Intergenic
1193104716 X:77657381-77657403 CTTTCTGGCCAGAGGAAGCAGGG + Intronic
1194404016 X:93471446-93471468 CTGTGTGAACATTGTAATCAAGG + Intergenic
1199575957 X:149314058-149314080 ATTTCTGAACAGAGGAAGAATGG + Intergenic
1200277096 X:154744127-154744149 CTTTGTGAACCCAGGAGGCGGGG + Intronic
1200385604 X:155887517-155887539 GTTGGTGACCTTAGGAAGCATGG + Intronic