ID: 1045820161

View in Genome Browser
Species Human (GRCh38)
Location 8:106327960-106327982
Sequence TTGTATTTTAAAAAGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045820158_1045820161 -10 Left 1045820158 8:106327947-106327969 CCAATTCAAATTATTGTATTTTA 0: 1
1: 1
2: 14
3: 85
4: 1189
Right 1045820161 8:106327960-106327982 TTGTATTTTAAAAAGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045820161 Original CRISPR TTGTATTTTAAAAAGGATGA GGG Intronic
No off target data available for this crispr