ID: 1045822899

View in Genome Browser
Species Human (GRCh38)
Location 8:106362052-106362074
Sequence TGACCTCTGTGTTTAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045822899_1045822904 7 Left 1045822899 8:106362052-106362074 CCACCTGCTAAACACAGAGGTCA 0: 1
1: 0
2: 2
3: 18
4: 162
Right 1045822904 8:106362082-106362104 AGGGCAGCTTCTTCGTGTCTAGG No data
1045822899_1045822905 13 Left 1045822899 8:106362052-106362074 CCACCTGCTAAACACAGAGGTCA 0: 1
1: 0
2: 2
3: 18
4: 162
Right 1045822905 8:106362088-106362110 GCTTCTTCGTGTCTAGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045822899 Original CRISPR TGACCTCTGTGTTTAGCAGG TGG (reversed) Intronic
902716675 1:18277433-18277455 TCACCTCTGTGTCTAGCACAGGG + Intronic
903456500 1:23490918-23490940 TGACCTCTGGGTTCAGCAGGTGG - Intergenic
908949281 1:69540087-69540109 TGCCCTGTGGGTTTAGCAGGTGG + Intergenic
913374452 1:118135157-118135179 GGACCCCTGTGATCAGCAGGTGG + Intronic
913495497 1:119424602-119424624 TAACCTCATTGTTTAGCAAGGGG + Intergenic
921274825 1:213508833-213508855 TATCTACTGTGTTTAGCAGGTGG + Intergenic
1063375618 10:5552627-5552649 TGACCTGTGTTTTTATGAGGGGG - Intergenic
1063983885 10:11480403-11480425 TGACCTCTTTTTATAGAAGGAGG + Intronic
1064103737 10:12484334-12484356 TGAACTCTGTGTTTGGAGGGAGG + Intronic
1066055377 10:31675931-31675953 TGACCTCTGTTTATACCATGAGG - Intergenic
1068459140 10:57303729-57303751 TGGCCTCTGTGTTTCCCAGTAGG + Intergenic
1068958447 10:62843186-62843208 TGACCTAAGTGGTTAGCAAGTGG - Intronic
1069800089 10:71076602-71076624 AGAGCTCTGTGTGTAGCTGGAGG - Intergenic
1073073596 10:100809764-100809786 TGACCTCTCTGGGAAGCAGGAGG - Intronic
1073825846 10:107320392-107320414 TGGTCTCTGAGTATAGCAGGAGG + Intergenic
1074543900 10:114387754-114387776 TGAGGTCTGTGTTTAGCTGTAGG - Intronic
1074705350 10:116125052-116125074 TGACCTCTGTGTCTGCCACGGGG - Intronic
1076547547 10:131255476-131255498 TGACCTCTGGGGTGAGCAGGAGG + Intronic
1077113280 11:871402-871424 TGTCCTCTGTGTGAAGGAGGGGG - Intronic
1078663225 11:13303922-13303944 TGAGCTATGTGTTTAGCTGGAGG + Intronic
1078851950 11:15171992-15172014 TCACCCCTGTGTTTGGGAGGAGG + Intronic
1079129974 11:17741590-17741612 AGACCTCTGTGGTTGCCAGGTGG - Intronic
1079130447 11:17744162-17744184 CGACCTCTGTATTTTACAGGTGG - Intronic
1080634161 11:34108723-34108745 TGACTTTTTTGTTTGGCAGGTGG + Exonic
1083771505 11:64870175-64870197 TGGCCTCTGTGTGTCTCAGGAGG + Intronic
1083968013 11:66054770-66054792 TGATCTCTGTGTGTAGGATGAGG + Intronic
1084266837 11:68009352-68009374 TGACCTCTTTGTTTTGCAGAAGG + Intronic
1085323909 11:75592291-75592313 GGAGCTCTCTGTCTAGCAGGGGG - Intronic
1085715224 11:78866649-78866671 TGGCCTCTGTGATTGCCAGGGGG - Intronic
1087851567 11:103036488-103036510 TGTCTTCTGTGTTTCTCAGGAGG - Intergenic
1088776770 11:113092827-113092849 ATACCTCTGTGTTTAGCATCAGG + Intronic
1089068344 11:115679255-115679277 TGCTCTCTGTGTTAAGCAGCTGG - Intergenic
1089887694 11:121844151-121844173 TGACCACTGTTCTTTGCAGGAGG - Intergenic
1092825973 12:12399069-12399091 TTACCTCTGTGTGTTTCAGGGGG + Intronic
1093219336 12:16400124-16400146 TGACCTCTATGCTGAGCAGATGG - Intronic
1095175723 12:39090044-39090066 TGACCACTGGGTTTTGCAGCCGG - Intergenic
1099684523 12:85867525-85867547 TGATCTCTGTGTTTAGAAGAAGG + Intergenic
1099795217 12:87391766-87391788 TGTTTTCTCTGTTTAGCAGGGGG + Intergenic
1100461589 12:94805043-94805065 TGACCACTGGATTTAGCAGTGGG - Intergenic
1102046375 12:109832655-109832677 TGTCCTCTCTGTTTTGCAGATGG - Intronic
1104397097 12:128443756-128443778 TGAGCTCTGTGTGTTGCAGCAGG - Intronic
1107046364 13:35997024-35997046 TAAACTCTGTTTCTAGCAGGAGG - Intronic
1110640941 13:77823022-77823044 AGGCTTCAGTGTTTAGCAGGTGG + Intergenic
1111454051 13:88456240-88456262 TGCCAGCTGTGTTTAGCAGAGGG + Intergenic
1112015196 13:95325695-95325717 TGACCTGTGCATTTAGCACGAGG - Intergenic
1112623982 13:101081511-101081533 TGACTTCTATGCTTACCAGGAGG + Exonic
1115346078 14:32344586-32344608 TGACCACTGTGTTAAGCAAGTGG + Intronic
1118613147 14:67556953-67556975 TGACCTCTGTGGATCCCAGGAGG - Intronic
1118914752 14:70093565-70093587 TGGCCTCTGTGTTTAGAAGAGGG - Intronic
1121782289 14:96629702-96629724 TCACCTCTGGGTTTGGCAGCTGG + Intergenic
1123218588 14:106836088-106836110 AGACCTCAGGGTATAGCAGGAGG + Intergenic
1126262420 15:46709593-46709615 TGACCTCTGTGATTCTCTGGAGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1129692604 15:77722277-77722299 TGGACTCTGGGTTTATCAGGAGG + Intronic
1129977196 15:79832212-79832234 TGACCCCTGTGTCTGTCAGGTGG + Intergenic
1130285182 15:82548846-82548868 TGACCTCTGTGATTAACATGTGG - Intronic
1131290556 15:91103124-91103146 TAAACTCTGTGTTTAGAAGAAGG + Intronic
1132809081 16:1789073-1789095 TGTCATCTGTGTTTAGCTCGGGG + Exonic
1133119848 16:3599262-3599284 TGACCTGTGTGCAAAGCAGGGGG + Intronic
1134181679 16:12052936-12052958 TGACTTCTGTGTTTATCTGCAGG + Intronic
1134266864 16:12700393-12700415 AGACCTCTGTGTTCAACACGTGG - Intronic
1135308409 16:21386689-21386711 TGACTTCTGTGTTTATCTGCAGG + Intergenic
1135739708 16:24964305-24964327 TGACCCCTTTGTTTTGCAGGTGG - Exonic
1136305153 16:29365824-29365846 TGACTTCTGTGTTTATCTGCAGG + Intergenic
1137384652 16:48030258-48030280 TGACCTCTGTGTTTTGCAAGGGG - Intergenic
1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG + Intronic
1141455261 16:84137119-84137141 TGACTTCTGTGTATACCGGGTGG - Intronic
1143701636 17:8664999-8665021 TGCCCTCTGGGTTTGGCAGGAGG + Intergenic
1143761453 17:9106918-9106940 TAACCTAAGTGTTTAGCACGGGG - Intronic
1151621340 17:75247164-75247186 TGAGCTCAGTGTTAAGCAAGTGG + Intronic
1152391336 17:80005727-80005749 AGACCTCTGGGTTTAGTAGGTGG + Intronic
1156110531 18:33720483-33720505 TTCCCTCTGTGTGTAGCAGAGGG - Intronic
1159797710 18:72864914-72864936 TGACTTCTGTGTTTCTGAGGTGG + Exonic
1160540869 18:79621715-79621737 TGACCCCTGTGTGTGGCAGCAGG - Intergenic
1160866135 19:1256935-1256957 GGTCCTCTGTGTTCAGCAGGTGG + Intronic
1161742917 19:6035213-6035235 TGGCCTCTGGGTCTTGCAGGAGG + Intronic
1162676952 19:12306325-12306347 CCACCTCTGAGGTTAGCAGGAGG - Intergenic
1164276423 19:23722837-23722859 TGCCCTCTGTCTTTGGCATGTGG + Intergenic
1165857658 19:38889665-38889687 TGAGATCTTTGTTTTGCAGGGGG - Intronic
1166152113 19:40882051-40882073 TGTGCTCTGTGTTCAGCTGGAGG + Exonic
1167712919 19:51123390-51123412 TGAGTTCTGTCTTGAGCAGGAGG - Intergenic
1167715244 19:51138638-51138660 TGAGTTCTGTCTTGAGCAGGAGG - Intergenic
1167740188 19:51320122-51320144 TGTCCACTGTGTTTAGCTCGGGG + Intronic
1168677154 19:58286833-58286855 TGACCTCTGAGCTTAGAAGATGG - Intronic
925533317 2:4888429-4888451 TGCCCTCAGGTTTTAGCAGGAGG - Intergenic
926749715 2:16188887-16188909 AGTGCTCTGTGTTTAGCAGCAGG + Intergenic
927222401 2:20725506-20725528 TTACCTCAGTGTTTGGTAGGTGG + Intronic
932021557 2:68092779-68092801 TGATATCTGTGTTTAGCGTGAGG - Intronic
932134896 2:69219738-69219760 TGTCCTCTGTTTTTAACAAGTGG + Intronic
932390055 2:71380692-71380714 TGGCCCCTGTATTAAGCAGGCGG + Intronic
936008215 2:108908542-108908564 TGACCTGTGTGCATTGCAGGGGG + Intronic
937449852 2:121993021-121993043 TGACCTCTTGGTTTTTCAGGTGG + Intergenic
938627175 2:133123622-133123644 TGCCCTCTGTATTCATCAGGAGG + Intronic
948744239 2:240074516-240074538 TGACCACAGTGTTTTGCAGGAGG + Intergenic
1169993818 20:11534301-11534323 TGACATCAGTGATGAGCAGGTGG + Intergenic
1171326804 20:24301786-24301808 TGCCCTCTCTGTTGAGCAGCGGG - Intergenic
1172854586 20:37992175-37992197 TGGGCTCTGGGGTTAGCAGGTGG + Intronic
1176268220 20:64221715-64221737 TGTCTTCTGTGTTTTGCTGGGGG + Intronic
1178327307 21:31656424-31656446 GGACCTCTGTGGTTAAAAGGTGG - Intergenic
1179512101 21:41879683-41879705 TGACCTCTGGATTTGGCCGGCGG + Intergenic
1179592040 21:42415286-42415308 TGACTTTTGTTTTTAGCAGTCGG - Intronic
1180167894 21:46039448-46039470 TAACATCTGTGTTTAGCAACTGG - Intergenic
949355086 3:3171839-3171861 AGACCTCTGTGTTGCCCAGGTGG - Intronic
949661036 3:6278819-6278841 TGACCACTGGATTTAGCAGATGG + Intergenic
953470747 3:43163943-43163965 TGTCCTGTGTGGGTAGCAGGAGG + Intergenic
955506603 3:59639109-59639131 TCACATGTGTGTTTTGCAGGGGG + Intergenic
958477331 3:94601615-94601637 TGGTCTCTGTGGTTAGCAGATGG + Intergenic
958649630 3:96922242-96922264 TTACTTCTTTATTTAGCAGGAGG - Intronic
959401082 3:105903190-105903212 TGAGCTCTGTGTGTAGTTGGAGG + Intergenic
960534271 3:118799449-118799471 TGATCTCTGTTTTTAGCTGTGGG + Intergenic
960766100 3:121132192-121132214 TGTCCTCTGTGCTAAGCAGCAGG - Intronic
961122730 3:124386506-124386528 CTAGCTCTGTGTATAGCAGGTGG - Intronic
961410130 3:126714405-126714427 TGACATCTGTGGTGAGCAGCCGG + Intronic
961975176 3:131016771-131016793 TGACCTCTGTGTTTTATAGGAGG + Intronic
968627599 4:1634182-1634204 TGACCTCGGGGTGTGGCAGGAGG + Intronic
970250988 4:14115884-14115906 TGATGTCTGTGTTTTCCAGGTGG - Intergenic
971036342 4:22696985-22697007 TGTCCTCTGTGTTTGGCTGGAGG + Intergenic
972908279 4:43778920-43778942 TGACCTGTCTGTTTATCATGTGG + Intergenic
974416902 4:61619828-61619850 TGAACTCTGTGTTATGGAGGAGG + Intronic
974647714 4:64716204-64716226 TGACTTTAGTGTTTAGAAGGCGG + Intergenic
975500799 4:75082354-75082376 TGTTATCTGTGTTTTGCAGGTGG - Intergenic
976215346 4:82710615-82710637 TGACCCCTGGGTTGAGGAGGGGG + Intronic
976389663 4:84496073-84496095 TGACGTCGGTGTTGAGCAGAAGG - Intronic
981548007 4:145914590-145914612 TGACTTCTGTGTGTACCAGAAGG - Intronic
984507268 4:180635413-180635435 TGATCTCTGCCTTTTGCAGGAGG + Intergenic
987743386 5:21938312-21938334 TGACCTCTGTGTTTTAAATGAGG - Intronic
991038936 5:62156525-62156547 TCCCCTCTGTGTTGACCAGGTGG - Intergenic
991749526 5:69786187-69786209 TGACCTCTGTGTTTTAGATGAGG + Intergenic
991763583 5:69948453-69948475 TGACCTCTGTGTTTTAGATGAGG - Intergenic
991783742 5:70169676-70169698 TGACCTCTGTGTTTTAGATGAGG + Intergenic
991801106 5:70366005-70366027 TGACCTCTGTGTTTTAGATGAGG + Intergenic
991827494 5:70644041-70644063 TGACCTCTGTGTTTTAGATGAGG - Intergenic
991842813 5:70823513-70823535 TGACCTCTGTGTTTTAGATGAGG - Intergenic
991876188 5:71170051-71170073 TGACCTCTGTGTTTTAGATGAGG + Intergenic
998007845 5:138668899-138668921 GGACCTCAGTGTCAAGCAGGAGG + Intronic
999960874 5:156754166-156754188 AGGCCTCTGAGATTAGCAGGAGG - Intronic
1000098179 5:157989264-157989286 TGAATTCTGAGATTAGCAGGTGG + Intergenic
1001668254 5:173451483-173451505 AGACCTCTGTGTTTTTCAGATGG - Intergenic
1002511048 5:179718031-179718053 TGATCTCTGTGTTGCCCAGGTGG + Intronic
1002545432 5:179940134-179940156 TGACCGCTGTGCTTAACAGACGG + Intronic
1003376161 6:5579594-5579616 TGTTCTCTGGGTTTAGCAGAAGG + Intronic
1007605376 6:43114080-43114102 TGTCCTGTGTTTCTAGCAGGGGG - Intronic
1008033147 6:46719495-46719517 TGACCTGTGTGTCAGGCAGGTGG - Intronic
1008715470 6:54284173-54284195 TGATGTCTGTGTTGAGGAGGAGG + Intergenic
1011261116 6:85470400-85470422 TGAGCTCTGTGTTAATCATGAGG - Intronic
1014173552 6:118306484-118306506 GTACCTCTGTGTTTTGCAGAGGG + Intronic
1018644103 6:165931837-165931859 TTTCCTCTGGGTGTAGCAGGAGG - Intronic
1019389501 7:778062-778084 GGACCTCAGAGTTCAGCAGGCGG - Intronic
1020269970 7:6589222-6589244 TGACCTGTGTGATGTGCAGGAGG + Exonic
1021645200 7:22782807-22782829 GGACCTCGGTGTCCAGCAGGGGG - Intergenic
1021709625 7:23402158-23402180 TGAGCTATGTATTAAGCAGGTGG - Intronic
1023793440 7:43771701-43771723 TGGCCTCTGTGTTTGCCATGTGG - Intronic
1024288861 7:47785660-47785682 TGACCTCCATGTTTATCAGCAGG + Intronic
1028776450 7:94682687-94682709 TGACTTTTGTGTATAGCAGGAGG - Intergenic
1033269308 7:139916417-139916439 TGACCTCTGTGTTGCTCATGAGG - Intronic
1034258872 7:149741718-149741740 AGTTCTCTGTGGTTAGCAGGGGG - Intergenic
1034698731 7:153078054-153078076 TCACCCCTGTGTCTAGTAGGCGG + Intergenic
1035111515 7:156486241-156486263 TGACCTGAGTGTTTCGCATGCGG + Intergenic
1038370723 8:26987094-26987116 TTAACTCTGTGTCTACCAGGAGG + Intergenic
1042894258 8:73649384-73649406 GGACCTCTGTGTTGAGAAAGGGG - Intronic
1043287129 8:78546793-78546815 TGACCTCTGTCTTCAGTAGCTGG - Intronic
1045219339 8:100182265-100182287 TGCCCTCTGTCTTTAGCAGTGGG + Intronic
1045822899 8:106362052-106362074 TGACCTCTGTGTTTAGCAGGTGG - Intronic
1046687639 8:117244915-117244937 TGGCCTTTGTGGTTTGCAGGAGG + Intergenic
1047844796 8:128794282-128794304 GGGCCTATGTGTTTAGCAGATGG + Intergenic
1049717995 8:144102647-144102669 AGAACTCTGTCTTAAGCAGGAGG + Intronic
1050351425 9:4743779-4743801 TGACCTCAGTGTTTTTCAGTTGG - Intergenic
1055082969 9:72285325-72285347 AGACCTATGTGTGTAACAGGAGG + Intergenic
1056729543 9:89153834-89153856 TGAGCTCTGGGTTTAACAGTAGG + Intronic
1056813631 9:89783476-89783498 AGACCTGTTTGTTTAGCAGATGG + Intergenic
1057567049 9:96174080-96174102 TGACCTCTTGGTTTACCAAGAGG - Intergenic
1060154226 9:121308104-121308126 TGACCTCGGTGTGGAGCAAGGGG - Intronic
1061678111 9:132229631-132229653 TGTCCTCAGGGTCTAGCAGGTGG + Intronic
1062088122 9:134659003-134659025 TGGCCTCTGTGTAAGGCAGGAGG + Intronic
1062424446 9:136499548-136499570 TGACCTCTCTGTTTTGTAGGTGG - Intronic
1191109597 X:56794236-56794258 TGACCTCGGTGCCTAGCAGAAGG + Intergenic
1192634074 X:72801922-72801944 TTCCCTCTGTGTCTAGGAGGAGG - Intronic
1192647636 X:72918879-72918901 TTCCCTCTGTGTCTAGGAGGAGG + Intronic
1194931871 X:99898615-99898637 AGACCTCTCTGTTTAACAGATGG - Intergenic
1195771611 X:108357474-108357496 TTACCTCAGTGTTTGTCAGGTGG - Intronic
1197360333 X:125493711-125493733 AGACCTCGGGGTATAGCAGGAGG - Intergenic
1199684398 X:150253814-150253836 TGGCCTCTGTTGTTAGCTGGTGG + Intergenic
1199806750 X:151307845-151307867 TGACCTTTGGGTGCAGCAGGTGG + Intergenic