ID: 1045823252

View in Genome Browser
Species Human (GRCh38)
Location 8:106366903-106366925
Sequence ATGTAATACATGAAAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 452}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045823252 Original CRISPR ATGTAATACATGAAAGAAGA TGG (reversed) Intronic
900723049 1:4191542-4191564 ATGTAATCCATCAAATAAGCAGG - Intergenic
901887546 1:12233300-12233322 ATGAAATTCATGAAAGAGGCCGG - Intronic
902077581 1:13800317-13800339 CTTGATTACATGAAAGAAGATGG + Intronic
904390822 1:30184640-30184662 ATGGACTAAAGGAAAGAAGATGG - Intergenic
906795103 1:48690362-48690384 ATGTAATAGATGCAAAAATAAGG + Intronic
906935297 1:50209256-50209278 CTGTGATACAGGAAAGCAGAGGG - Intergenic
907211844 1:52830463-52830485 CTTTAATACATAAAAGATGAAGG - Intergenic
908041374 1:60117292-60117314 ATGTAATGCAAGAAAGAGGCTGG - Intergenic
908149336 1:61283728-61283750 ATTTAAAACATTAAACAAGAAGG - Intronic
909092425 1:71243143-71243165 AAGTATTACATGAAAAAAAATGG - Intergenic
909195276 1:72613030-72613052 ATGTAACAAATGAAAGAATAAGG + Intergenic
909209074 1:72799554-72799576 ATATAATAAATGAAAGGACAAGG - Intergenic
909684803 1:78335864-78335886 ATGTAATAATTGGAAGAACAAGG - Intronic
909716924 1:78719514-78719536 TTGAAATAAATGAATGAAGAAGG - Intergenic
910071663 1:83221754-83221776 ATGAATTACATGATAGAATAAGG - Intergenic
910135388 1:83962430-83962452 ATTTAAGACATAAAAGTAGATGG - Intronic
910332806 1:86094942-86094964 TTGTGATACAAGAAAGAAAATGG - Intronic
910960286 1:92754984-92755006 ATGTTATATCTTAAAGAAGATGG + Intronic
911697545 1:100908154-100908176 AGACAGTACATGAAAGAAGATGG - Intronic
911742454 1:101401495-101401517 ATGAAACACAGGAAAGCAGAGGG - Intergenic
911989603 1:104675861-104675883 ATGAAATACATGAAATATGTTGG + Intergenic
912239459 1:107889974-107889996 AGGTAATACAATAAAGAAAAAGG - Intronic
913235663 1:116779954-116779976 ATGAAAAACATGAAATAAAATGG + Intergenic
914380199 1:147108812-147108834 ATGAAACACAGGAAAGAGGATGG + Intergenic
914419167 1:147513033-147513055 ATGAAATAGATGAAAGGATATGG + Intergenic
915170767 1:153975712-153975734 ATGGAATATCTGAAAGAAGAGGG - Intronic
917301389 1:173578220-173578242 GTATAATTCATGAAAGAACATGG - Intronic
917711717 1:177691995-177692017 AGGTAACACATGAAAGAGTAAGG + Intergenic
917784755 1:178442312-178442334 AGCTAGTACATGATAGAAGAGGG + Intronic
918144495 1:181743574-181743596 ATGAAACACATGAAACATGAGGG - Intronic
918396192 1:184115507-184115529 CTGGAACACAGGAAAGAAGAGGG + Intergenic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
918599332 1:186336223-186336245 TTGTTATCCATGAAAGCAGAAGG + Intronic
919534230 1:198766903-198766925 AAGAAATAAATGAAGGAAGAAGG + Intergenic
919701306 1:200633935-200633957 ATGTAGTCAATGAAAGTAGAAGG - Intronic
921668818 1:217904167-217904189 ATATAAGACCTGAAACAAGAAGG - Intergenic
922020885 1:221703550-221703572 ATGTCATACATGGAAGCAAACGG - Intronic
922543938 1:226440936-226440958 ATGTCATACATCACAAAAGAAGG - Intergenic
1063601038 10:7481814-7481836 AGTTAATGAATGAAAGAAGAGGG + Intergenic
1064061918 10:12145084-12145106 GTGGAAGAAATGAAAGAAGAGGG + Intronic
1064541305 10:16407790-16407812 TTGTAATACAAGAAAAAAAAAGG + Intergenic
1064928697 10:20599128-20599150 ATGTAAAAGAGGAAATAAGAGGG - Intergenic
1065691388 10:28337400-28337422 ATATAAATCATGAAGGAAGAAGG + Intergenic
1066035836 10:31482743-31482765 ATGTATTACCTGAAAAAAGTTGG + Intronic
1066185478 10:33006165-33006187 GTTTATTACATGAAAGCAGATGG - Intergenic
1066205951 10:33189398-33189420 ATGTAAAAGATGACGGAAGAGGG - Intronic
1067516162 10:46946662-46946684 ATGTCATACCAGAAAGTAGAGGG - Exonic
1067646085 10:48105148-48105170 ATGTCATACCAGAAAGTAGAGGG + Intergenic
1068168685 10:53364508-53364530 ATGTTATAAAAGAAGGAAGAAGG - Intergenic
1068895268 10:62191921-62191943 ATGTAACACGTGTATGAAGAGGG - Intronic
1069130833 10:64700213-64700235 ATGTAATATGTGAGACAAGATGG + Intergenic
1069417184 10:68210892-68210914 ATGTAATCGATGAAAGGTGATGG - Exonic
1070051792 10:72896535-72896557 ATGTAAGACAAGAAATAAGTGGG - Intronic
1070472777 10:76800573-76800595 ATTTAATAAATTAAAGAAAATGG - Intergenic
1070845341 10:79518199-79518221 ATGTAATTCAAGAGAGAAGTGGG - Intergenic
1070928451 10:80242111-80242133 ATGTAATTCAAGAAAGAAGTGGG + Intergenic
1073503094 10:103959972-103959994 ATGTAATACATAAAAGTAGGGGG + Intergenic
1073668428 10:105560076-105560098 AAGAAATAAATGAAAGAAGAAGG - Intergenic
1077786317 11:5387861-5387883 ATGTAATGCAATAAAGAAGTAGG - Intronic
1078246596 11:9578541-9578563 ATGCAATACCTGAAAAATGAAGG - Intronic
1078499706 11:11859172-11859194 ATGTAATACATAAAGGATGCTGG - Intronic
1078689938 11:13569786-13569808 ATGTTAAACATAAAAGAAAATGG + Intergenic
1079211767 11:18467433-18467455 AAGTTAAAAATGAAAGAAGATGG - Intronic
1079549471 11:21675937-21675959 ATGAATTACATGTAAGAGGATGG + Intergenic
1080100537 11:28454735-28454757 ATGAGATACATTTAAGAAGAAGG - Intergenic
1080737343 11:35029562-35029584 ATGAAATATATGAAAGTACATGG - Intergenic
1080759905 11:35238393-35238415 AGGTAAAACCAGAAAGAAGAGGG + Intergenic
1081028074 11:38040545-38040567 AAGTAGTCCATGAACGAAGAAGG - Intergenic
1081372266 11:42318258-42318280 GGGAAAAACATGAAAGAAGAAGG - Intergenic
1081825769 11:46049975-46049997 ATGAAATATATGATAGAATATGG - Intronic
1081984955 11:47294950-47294972 AGAAAATACATGAAAGAATAAGG - Intronic
1082647280 11:55743279-55743301 ATGTAAAACATGAAGGAGAAAGG + Intergenic
1082908630 11:58343553-58343575 ATGTAATACCTGAATAAAAATGG - Intergenic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1085105766 11:73841508-73841530 ACCTAATGAATGAAAGAAGACGG + Intronic
1085782721 11:79424041-79424063 TTGTCATACATTAAAAAAGATGG + Intronic
1086037187 11:82430943-82430965 TTGTGATACATTAATGAAGAGGG - Intergenic
1086433901 11:86763003-86763025 AAGTATTTCATGAAAGAAGAAGG - Intergenic
1086492804 11:87372363-87372385 ATGTAATTCATGGAAGAGGCAGG + Intergenic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1087250863 11:95898053-95898075 ATGTAGTATTTGAAAGAAAAAGG - Intronic
1087510245 11:99083251-99083273 ATTTAAAAAAGGAAAGAAGAGGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088977225 11:114826547-114826569 AAGTGAGACATGTAAGAAGAGGG - Intergenic
1089434400 11:118451996-118452018 ATGTAATACATGAATCAGGAGGG + Intronic
1089905949 11:122038785-122038807 ATGTGAGACATGCATGAAGAAGG + Intergenic
1090141272 11:124266147-124266169 ATCAATTACATGAAAGAAAAGGG - Intergenic
1090886659 11:130882964-130882986 TTGTAAGACATGCCAGAAGATGG - Intronic
1090982927 11:131739263-131739285 ATGAAATAAACAAAAGAAGATGG + Intronic
1090985869 11:131765575-131765597 ATGTTATACATGAGATAAGTAGG - Intronic
1092257240 12:6934039-6934061 ATGAGAGACATGAAAGATGAGGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092568278 12:9693032-9693054 AGGTTAGTCATGAAAGAAGATGG + Exonic
1092591920 12:9959915-9959937 ATGTCATACATGAAACAATTAGG + Intronic
1092611648 12:10179358-10179380 AAGAAAAACAGGAAAGAAGAGGG + Intronic
1092872884 12:12822152-12822174 ATGTTCTACATGAAACAAGTGGG - Intronic
1093062990 12:14626927-14626949 AAGTGATAAATGAAAGGAGAAGG + Intronic
1095923679 12:47557201-47557223 ATGTAATAGATAAAAGCAGAGGG + Intergenic
1096753293 12:53777165-53777187 ACTAAATACATGAAAGCAGATGG - Intergenic
1097126591 12:56781264-56781286 ATTAAAAACATGAAAGAAAAGGG - Intronic
1098148604 12:67523108-67523130 AGGGAATCCATGAAAGCAGAAGG - Intergenic
1098230352 12:68366723-68366745 ATGTAAGGTATGAGAGAAGAAGG - Intergenic
1098423899 12:70336879-70336901 ATGTAAAACATGCAAGAACTGGG - Intronic
1098471929 12:70855240-70855262 ATGTTTTACATCCAAGAAGACGG + Intronic
1098903071 12:76132703-76132725 ATGTATTACATGACAGGAGCAGG + Intergenic
1099506913 12:83489484-83489506 ATGTAATTCTTTAAGGAAGAGGG - Intergenic
1100726315 12:97412664-97412686 CTGCAATAAATGAAAGAAAAGGG + Intergenic
1100769716 12:97908507-97908529 ATATCATACATTAAAGATGATGG - Intergenic
1100792381 12:98144571-98144593 ATGTGACAAATGAAAGAAAAAGG + Intergenic
1101363424 12:104049283-104049305 ATATAATTTATGAAATAAGAAGG - Intronic
1101431218 12:104628946-104628968 ATGTACTACATGAAACAAGGGGG + Intronic
1101532979 12:105591363-105591385 CTGTCTTACATGAAAGAAGCTGG - Intergenic
1101593372 12:106141519-106141541 ATGGCATATATGAAAGGAGAAGG - Intergenic
1102715834 12:114971648-114971670 AGGTAATATATGAAAGATCATGG - Intergenic
1102724466 12:115048245-115048267 TTTTAAAACAGGAAAGAAGATGG + Intergenic
1104216685 12:126740780-126740802 AATTAAAACATGAAATAAGATGG - Intergenic
1104234199 12:126917249-126917271 ATTTTATGCAAGAAAGAAGATGG + Intergenic
1106887192 13:34200331-34200353 AGCTAATACATGCAAGAAAATGG - Intergenic
1107306533 13:39026388-39026410 CTGTAATATAAGAAAGAAGAGGG + Intronic
1107344322 13:39442524-39442546 AGGGAAGGCATGAAAGAAGAAGG + Intronic
1107370988 13:39747443-39747465 ATGTATTACATGAATGAAGGAGG - Intronic
1107529707 13:41271542-41271564 AACTAAAACATGAAAGACGATGG - Intergenic
1107756655 13:43630951-43630973 ATGTAATACATATAATTAGATGG + Intronic
1107897114 13:44976269-44976291 ATGCAAAAAATGAAAGAAGAAGG + Intronic
1108308993 13:49166735-49166757 ATGTAAAACAAGGAAGGAGAAGG - Intronic
1108726399 13:53187266-53187288 ATGGAATACATGGAACAACATGG + Intergenic
1109440266 13:62361506-62361528 ATGCAATACTTTAAAGAATAAGG - Intergenic
1110118775 13:71854480-71854502 ATAAAATGCATGAAAGGAGAGGG - Intronic
1110129378 13:71988267-71988289 ATATAATATATGAAAGAACCAGG + Intergenic
1110759467 13:79215258-79215280 ATAAAATACATGAAAAAACAAGG - Intergenic
1112079619 13:95955008-95955030 ATGTCTTACAAGAAAGTAGAGGG + Intronic
1112803302 13:103135720-103135742 ATTTAATAGATGAAAGAATTGGG + Intergenic
1113977885 13:114244611-114244633 TTGTAATACATAAAATAAGTAGG - Intronic
1115067252 14:29278931-29278953 ATGTAATGTGTGGAAGAAGAAGG + Intergenic
1117058530 14:51937088-51937110 ATGTAAGACATTAAAGATAAAGG - Intronic
1117109996 14:52442617-52442639 ATTTAAGCCATGAAAGAGGAAGG - Intronic
1117957162 14:61131548-61131570 AGGTCAAAAATGAAAGAAGATGG + Intergenic
1120223489 14:81763426-81763448 ATGTCAGATATGAAGGAAGATGG - Intergenic
1120325678 14:83022369-83022391 ATGAAATATATGAGAGATGATGG - Intergenic
1120379470 14:83756494-83756516 ATGTATTCCAAGGAAGAAGATGG - Intergenic
1120537805 14:85718420-85718442 ATGTAATACATTATATATGATGG - Intergenic
1121952186 14:98181129-98181151 AAGAAATAAATGAAGGAAGAAGG - Intergenic
1124469882 15:29974539-29974561 ATGTTATACAAGAAATAACAAGG + Intergenic
1125292117 15:38161426-38161448 ATTTAATACCGAAAAGAAGAAGG - Intergenic
1125757425 15:42072903-42072925 ATGCAAAGCAAGAAAGAAGAGGG - Intronic
1126616147 15:50582321-50582343 ATATAAAACATGAGAAAAGAAGG - Intronic
1126970298 15:54103618-54103640 ATGAATTAAATGAAAGAACAAGG - Intronic
1127005872 15:54569650-54569672 ATATAATACATGTAATAAAAAGG - Intronic
1127951967 15:63816801-63816823 ATCTAACACATGAATGAAGAAGG + Intronic
1129096335 15:73212396-73212418 CTATAATATATGAAAGAAGAAGG - Intronic
1129419078 15:75408899-75408921 ATTTAAAGCATCAAAGAAGAAGG + Intronic
1129430211 15:75495167-75495189 ATAGAATAAAAGAAAGAAGATGG + Intronic
1130002247 15:80057887-80057909 CTGGAACACAGGAAAGAAGATGG + Intergenic
1131452421 15:92555052-92555074 ATGAAATACATGAAATTACAAGG + Intergenic
1131937771 15:97525742-97525764 ATGGAAAAAAGGAAAGAAGAAGG + Intergenic
1133513369 16:6482964-6482986 ATGTACCACATGACAGAATAGGG - Intronic
1133513371 16:6482987-6483009 ATTTAATGCCTGAAAGAACAAGG + Intronic
1138848138 16:60592345-60592367 TTGTATTAAGTGAAAGAAGATGG + Intergenic
1139360296 16:66394473-66394495 ATGTAAAACAAGATAAAAGAAGG - Intronic
1139903196 16:70344385-70344407 ATGAAATACATGCAATAACATGG - Intronic
1140563287 16:76009488-76009510 ATAGAATAAATGAAAGAATAGGG + Intergenic
1140582563 16:76248998-76249020 AATAAATACATGAAAAAAGAAGG + Intergenic
1141870949 16:86785104-86785126 TTGTGCTACATGAAAGAACAGGG - Intergenic
1143304673 17:5936966-5936988 ATTTAAAAGATGAAAGAAAATGG + Intronic
1144183362 17:12773027-12773049 ATCTGATACTTGAAACAAGATGG + Intergenic
1146090396 17:29871900-29871922 ATGTAATATAAGAAAAAATAGGG - Intronic
1148714585 17:49707075-49707097 ATGAAATGCATGAGAAAAGAGGG + Intronic
1149510860 17:57240283-57240305 ATGAAAGAGATGATAGAAGATGG + Intergenic
1149916266 17:60612889-60612911 CACTAAAACATGAAAGAAGAAGG - Intronic
1150361367 17:64537589-64537611 ATGTAATGTCTGAAAAAAGAAGG - Exonic
1150436332 17:65157157-65157179 ACATAACACATCAAAGAAGAGGG - Intronic
1150489148 17:65562370-65562392 ATGTAACATATGGCAGAAGAGGG - Intronic
1150855051 17:68744740-68744762 ATGTATGAGATGAAAGAAAAGGG - Intergenic
1152501248 17:80710761-80710783 ATTTAATATATGAAACAAAATGG - Intronic
1153102531 18:1489636-1489658 ATGTAATGTATGAAAGATTAAGG - Intergenic
1153457968 18:5299243-5299265 ATTTAAGACCTGAAAGATGAGGG + Intergenic
1154943342 18:21136738-21136760 ATGTAAGAAATAAAAGAAGGTGG - Intergenic
1155088882 18:22486544-22486566 CCCTAATTCATGAAAGAAGATGG + Intergenic
1155649073 18:28118342-28118364 AAGTCATACATAATAGAAGATGG - Intronic
1155806578 18:30177689-30177711 ATAGAATGCATGAAAGCAGAAGG + Intergenic
1156273211 18:35556494-35556516 AAATAATACATAAAAGGAGATGG + Intergenic
1156320893 18:36020910-36020932 ATGTATTACATGAAAAAGAAAGG + Intronic
1157199715 18:45649628-45649650 AAGTAATATATGAGAGAATATGG + Intronic
1158144226 18:54292812-54292834 ATTTAATAAATGGAATAAGAAGG - Intronic
1158832412 18:61294502-61294524 ATGTCATACATGCACCAAGAAGG - Intergenic
1159192114 18:65059883-65059905 GTGTAATAACTGAAAGAAAAGGG - Intergenic
1159244296 18:65784884-65784906 ATGTAACACATAAATGAACAAGG - Intronic
1159278650 18:66254374-66254396 GGGTAATACATGAAAGAAGAAGG - Intergenic
1159688564 18:71456465-71456487 ATTTAGGACATGAAAGAAAATGG - Intergenic
1161775863 19:6261751-6261773 ATATAATACTTGAAGGAAAAAGG - Intronic
1161990907 19:7683631-7683653 ATATAATAAATGAGGGAAGAAGG - Exonic
1162271077 19:9616047-9616069 ATTTACTACATCAAAGAATAGGG + Intronic
1164976490 19:32576691-32576713 ATGGAAGACATGAAAGAAAAGGG + Intergenic
1166463236 19:43008666-43008688 ATGTAATATATAAAATAAGGTGG + Intronic
1166503135 19:43355470-43355492 GTGTAATCCATAAAAGAGGAAGG - Intronic
1166507319 19:43379288-43379310 GTGTAACCCATGAAAGAGGAAGG + Intergenic
1167777416 19:51568380-51568402 ATGAGATATATGAAAGAAAAGGG + Intergenic
926584463 2:14670928-14670950 ATAAAATACATGAAAAAAGTAGG - Intergenic
927742706 2:25586703-25586725 ATTAAAAACATCAAAGAAGAAGG + Intronic
929618178 2:43328678-43328700 ATGTAATCTGTGAAAGCAGAGGG + Intronic
930413341 2:51055582-51055604 ATTTAATAAATGAAGAAAGAAGG - Intergenic
930550826 2:52833067-52833089 ATTAAAAACATAAAAGAAGAAGG + Intergenic
931479247 2:62622805-62622827 AGTTAATACATAAAAGGAGAGGG - Intergenic
932549205 2:72750229-72750251 ATTAAGTACATGAAAGAGGATGG + Intronic
933010532 2:77056217-77056239 ATGTGATATATGAAAAAATAAGG + Intronic
933372976 2:81440750-81440772 ATGTAAGAGATGATAGAAAATGG - Intergenic
935946573 2:108291886-108291908 TTATAATACATCAAAGAAGGTGG - Intronic
936488432 2:112947440-112947462 ATTTAATAAGTGAAAGAAGAAGG - Intergenic
936729729 2:115366394-115366416 ATATAATAAAGTAAAGAAGAAGG - Intronic
937998636 2:127714346-127714368 ATGAAATGCCTGAAAGAATAGGG - Intronic
938027179 2:127959884-127959906 ATGTAATAACTGAAATAAGACGG + Intronic
938107416 2:128542784-128542806 AGGGAATACATCAAGGAAGAGGG - Intergenic
939037167 2:137147196-137147218 TTGTAATACATGAATGCACATGG + Intronic
939385390 2:141489325-141489347 CTGTAATACATCCAAGAAAATGG - Intronic
939463624 2:142529415-142529437 AATTAATATATGAAAGAAGGTGG + Intergenic
939854094 2:147336291-147336313 ATCTAATACATGAATAAAAATGG + Intergenic
939955392 2:148523675-148523697 ATGTAACATAAGGAAGAAGAGGG + Intergenic
940021212 2:149157716-149157738 ATCTAATAGTTGAAAGAAAAGGG - Intronic
940058837 2:149542385-149542407 TTATAATATATGTAAGAAGAGGG + Intergenic
940115286 2:150201662-150201684 TTGTAATACTTGAAAAAAAAAGG + Intergenic
940297851 2:152147190-152147212 ATTAAATCTATGAAAGAAGAAGG - Exonic
940996692 2:160157413-160157435 ATGTAATACATGGTAGAAATAGG + Intronic
941260817 2:163294741-163294763 ATGTTTTACAAGAAATAAGAAGG + Intergenic
941380150 2:164782977-164782999 ATGTAATATATGAAAAAAAATGG - Intronic
941578206 2:167262658-167262680 ATGTTATAAAGGAATGAAGATGG + Intergenic
943778086 2:191789738-191789760 ATGTAATATAAGAAAGACTATGG - Intergenic
943968885 2:194376903-194376925 ATGTAATAAAAGAAAGACTATGG + Intergenic
945344131 2:208692913-208692935 AAGTAATACAGGAAAGCAAAAGG - Intronic
945618982 2:212109473-212109495 AAGTAATAGCTGAAAGAAGTGGG - Intronic
946668259 2:222074162-222074184 AGGGGATTCATGAAAGAAGAGGG - Intergenic
947061289 2:226169429-226169451 ATGAAATGCATGAAAGATCAAGG - Intergenic
947072458 2:226305655-226305677 ATGTGTAACAAGAAAGAAGAGGG + Intergenic
947457283 2:230266431-230266453 ATTTAAAACTTGGAAGAAGATGG + Intronic
1169026281 20:2374335-2374357 ATGGAAGAAATGAATGAAGAGGG + Intergenic
1169787918 20:9380404-9380426 ATCTAATACAAGAAAGTACATGG - Intronic
1169879541 20:10331535-10331557 ATGTCATAAACCAAAGAAGAAGG + Intergenic
1170114470 20:12842146-12842168 ATTTAAGACATGAAAGAAGATGG - Intergenic
1172224143 20:33293244-33293266 ATGTAATAAATGAAAAAATTTGG + Intronic
1172332445 20:34084747-34084769 ATGTCAGACATGAGAGAGGAAGG + Intronic
1173106297 20:40138311-40138333 ATGTAATCCATGTAAGTACATGG - Intergenic
1174720941 20:52811896-52811918 AGGTAATACATGTAATAAGAAGG - Intergenic
1174956360 20:55103113-55103135 GTTTAATAAGTGAAAGAAGAAGG + Intergenic
1174960669 20:55153716-55153738 CTGGAATGCAAGAAAGAAGAAGG - Intergenic
1175181380 20:57150164-57150186 ATTGAATTCATGAAACAAGAAGG + Intergenic
1175472240 20:59238597-59238619 AGCTAATACATGGAAGAAGAAGG + Intronic
1177125563 21:17189630-17189652 ATGTAATACATGTTATAACATGG + Intergenic
1177202790 21:17976832-17976854 ATGACTCACATGAAAGAAGAGGG - Intronic
1177620049 21:23578220-23578242 ATACCATACATGACAGAAGATGG - Intergenic
1179231616 21:39508808-39508830 ATATAATGTATGAAAGAAGTAGG + Intronic
1181394083 22:22605975-22605997 AAGCAATGCAAGAAAGAAGACGG + Intergenic
1182727678 22:32460959-32460981 GTGTAATACATGATAGAGTAAGG - Intronic
1182777019 22:32838757-32838779 AGGTAATACAATAACGAAGACGG - Intronic
1182919016 22:34062453-34062475 ATGTGTTACATGAAAGAATAAGG + Intergenic
1183055729 22:35304404-35304426 TTGAAATCCTTGAAAGAAGAGGG - Intronic
950239021 3:11351265-11351287 TTGTAATACATGCAGGAAGCAGG + Intronic
950985962 3:17366563-17366585 ACATAATACATGAAATATGAAGG - Intronic
951068772 3:18300560-18300582 ATATAAAAAATCAAAGAAGATGG + Intronic
951155239 3:19344613-19344635 ATGTTATCCTTGAAAGGAGATGG - Intronic
951208806 3:19951912-19951934 AAGAAAAAGATGAAAGAAGAAGG + Intronic
951379016 3:21959711-21959733 CTGAAATACTTGAAACAAGAAGG + Intronic
951668781 3:25157131-25157153 AAGTAATACAGGAAACAATAAGG + Intergenic
951677124 3:25254164-25254186 ATGTAATACATCATGGAATAAGG + Intronic
952002021 3:28797001-28797023 ATGCAATCCATGAAAGTGGATGG + Intergenic
952111046 3:30124260-30124282 ATGTAAGGAATGAAAGTAGAAGG + Intergenic
952912986 3:38206905-38206927 ATGTTATACATGAGAAAATAAGG - Intronic
954996737 3:54888633-54888655 ATGTAACACATGAAAATATAAGG - Intronic
955055832 3:55455330-55455352 ACGTTATATATGCAAGAAGAGGG + Intergenic
955287443 3:57656385-57656407 ATGTAATACATGAATGCACATGG - Intronic
955464092 3:59218052-59218074 ACATAAAACATGAAAGATGAGGG - Intergenic
956215183 3:66841370-66841392 ATTTGATACTTGAAAGAATAGGG + Intergenic
956410447 3:68973322-68973344 ATGTAATGCAGGAAGGAAGGAGG - Intergenic
956686687 3:71835603-71835625 AGGTAAGAAATGAAAGAAAAAGG - Intergenic
958061429 3:88486967-88486989 ATGGAATAAATGGAAGAAAAGGG + Intergenic
958092718 3:88897196-88897218 AAGTAACACATTAAAGAAGAGGG + Intergenic
958177112 3:90010520-90010542 ATGTAATATAAGCAATAAGAGGG + Intergenic
958533667 3:95367360-95367382 AAGTAATACATGACAGAAGTGGG - Intergenic
959583923 3:108008488-108008510 ATGTAATGCATAAAAGAAGGAGG + Intergenic
959834377 3:110901202-110901224 AAGTAATAAATTAAAAAAGAGGG - Intergenic
960058126 3:113290760-113290782 AAGTAAAACCTGAAAGAAAATGG + Exonic
960203852 3:114871074-114871096 CTGTGATACAAGAAAGGAGAAGG + Intronic
960267562 3:115637973-115637995 ATGTCATTCATGCAAGATGAGGG + Intronic
960325622 3:116292122-116292144 ATGAAATAAATAAAAGAAGTAGG - Intronic
960767744 3:121155473-121155495 CTTGAACACATGAAAGAAGAAGG - Intronic
961227536 3:125265893-125265915 ATGTAAAACAAGAAAGAGTAGGG + Intronic
961575440 3:127832135-127832157 TTGTGAAACATGAAGGAAGAAGG + Intergenic
961775805 3:129284171-129284193 ACGTAAGAGATGAAACAAGAAGG - Intronic
963073757 3:141327737-141327759 ATGTAATACATGAATAATGGAGG + Intronic
963633856 3:147768448-147768470 ATGAAATACTTGAAAAAAAAAGG - Intergenic
963722962 3:148885218-148885240 ATGTAAAACATGGAAGAAAATGG + Intronic
964052538 3:152413490-152413512 ATGTAATACTTGAAATCAGTAGG - Intronic
964672455 3:159241556-159241578 ATATAATACAGCAAAGAGGATGG - Intronic
965298580 3:166979950-166979972 ATGGAATAAATGAATGAATAAGG + Intergenic
965346148 3:167553259-167553281 ACGGAAAACATGAAGGAAGATGG + Intronic
966087147 3:176081603-176081625 AGGAAATAGAGGAAAGAAGACGG + Intergenic
967673103 3:192262491-192262513 ATGTACTACATATAAGAAGATGG + Intronic
969762241 4:9196369-9196391 ATGTCTTAGATGAAAAAAGATGG - Intergenic
970015641 4:11509732-11509754 ATGAAATTCATGACAGAAGCAGG + Intergenic
970052819 4:11934754-11934776 ATGTTCTACATGTTAGAAGAAGG + Intergenic
970157725 4:13158446-13158468 AAGAAATACATGAAACAGGAAGG + Intergenic
970915770 4:21332681-21332703 ATGTAATACATTACAGGAAATGG - Intronic
971325247 4:25638156-25638178 ATGTGAGTCCTGAAAGAAGATGG + Intergenic
971662898 4:29443002-29443024 ATGAGGTACTTGAAAGAAGAGGG + Intergenic
972060939 4:34872342-34872364 ATGTAATACATGTAGGAAGTTGG - Intergenic
972138533 4:35925179-35925201 CTGAAAGACATGAAAGAAAAGGG + Intergenic
972719535 4:41682361-41682383 ATGAAAAACAAGACAGAAGATGG + Exonic
973069662 4:45841834-45841856 AACTAATACAAGAAAGAAGGAGG + Intergenic
973544334 4:51965907-51965929 ATGTGATACTTGAATGTAGAGGG + Intergenic
974429494 4:61777389-61777411 ATGTACTACATAAAATAAAAAGG - Intronic
974534794 4:63161228-63161250 ATATAACACATGATAGAAGCGGG + Intergenic
974802511 4:66836451-66836473 ATGTAATTGATGAAAGAACTAGG - Intergenic
975137194 4:70886568-70886590 TTGTAATAGATGATAGAAGTAGG + Intergenic
976041620 4:80892118-80892140 CTGTAATAACTGAAAGAACATGG + Intronic
976341070 4:83945414-83945436 ATGTAATACATGATCCAAGGAGG - Intergenic
976545078 4:86326182-86326204 AGGAAACACATGAAAGAACATGG + Intronic
976782868 4:88780507-88780529 AACTAATACATTAAGGAAGAAGG + Intronic
977140112 4:93360276-93360298 ATGGAATACATAAAAGCAAAAGG - Intronic
977595094 4:98870485-98870507 ATATAATAGGTGAAATAAGAGGG - Intergenic
977639541 4:99341050-99341072 ATGTAATAAATCAATGAAAAAGG - Intronic
977857356 4:101909909-101909931 ATGTAAACCATGACAGAAGAGGG + Intronic
977966865 4:103162032-103162054 AATTAATACATGAATGAATAAGG + Intronic
978453136 4:108858819-108858841 ATGGAAAAAATGAAAGTAGAAGG + Intronic
979495892 4:121381413-121381435 ATGTAATGAATGAAAGAAACTGG - Intergenic
979803683 4:124943857-124943879 ATTTAATATTTGAAAAAAGATGG + Intergenic
980473563 4:133280019-133280041 ATGTAAAACATGGAAAAATATGG - Intergenic
980476192 4:133320573-133320595 ATGTAGAACATTAAGGAAGAAGG - Intergenic
981226804 4:142306086-142306108 TTCTAATACACGAAAGAAAATGG + Intronic
981264960 4:142771462-142771484 ATGTAGTTCAGGAAAGAATATGG + Intronic
981927502 4:150155888-150155910 ATGTAAAGCAGGAAGGAAGAAGG + Intronic
982913294 4:161173421-161173443 ATGTTGTACATGAAAAAAGTGGG + Intergenic
984552011 4:181171671-181171693 AAGAAATAAAAGAAAGAAGAGGG - Intergenic
984569439 4:181374207-181374229 GTGTAATCCATGCAAGAAGAGGG + Intergenic
984749843 4:183261543-183261565 AGGGAATACATGAAAGCAAAGGG - Intronic
986071258 5:4286961-4286983 ATGGAAAACAGGAAAGAAGAGGG - Intergenic
986973591 5:13368198-13368220 ATGTAAACCAGGAAAGAAGTGGG + Intergenic
987737223 5:21861949-21861971 ATATAATACATGAAAAAAGTGGG - Intronic
988656873 5:33221451-33221473 ATGTAATCTATTAAGGAAGACGG - Intergenic
988847216 5:35140245-35140267 ATGTAATAAATGAAGAAAAAGGG + Intronic
988888284 5:35583398-35583420 ATGTACTACATAAACGTAGATGG - Intergenic
988932851 5:36053915-36053937 CTGTTATAAAGGAAAGAAGATGG - Intronic
989007908 5:36835601-36835623 ATCTATTACATGAAAGAAACGGG + Intergenic
989540837 5:42616893-42616915 AAGTAATATAAGAAATAAGAAGG + Intronic
990081461 5:51920343-51920365 AAATAATACATGAAAGATGATGG + Intergenic
990413237 5:55561872-55561894 ATTTAATATATGAAAATAGATGG + Intergenic
990549377 5:56858408-56858430 ATATAAGACATGAGTGAAGAGGG + Intronic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
993074096 5:83205382-83205404 ATGTAATAGAGGAAAAGAGAAGG + Intronic
993265306 5:85719558-85719580 ATGGAATTCAAGACAGAAGAGGG + Intergenic
993329282 5:86576952-86576974 ATGCAATACATTAAACAAGATGG - Intergenic
993652413 5:90537793-90537815 ATGTTTTACATGCAAAAAGAAGG + Intronic
993725769 5:91364931-91364953 ATGAAATAAATGAATGAATATGG - Intergenic
993826440 5:92692990-92693012 ATGCAATAGAGGAAAGAAGAAGG + Intergenic
993855659 5:93071360-93071382 ATTAAATACATGAAAGCAAAGGG + Intergenic
993862001 5:93147566-93147588 ATGTGATTTATGAAAGCAGAGGG + Intergenic
993918836 5:93774540-93774562 ATGTAAGAACTGAAACAAGAAGG - Intronic
994440612 5:99798826-99798848 ATGTAAGACAGGAAAGTAGTCGG + Intergenic
995160301 5:108972056-108972078 AAGCAAAACATTAAAGAAGATGG - Intronic
995257029 5:110058637-110058659 ATGGAAAACATAAAAGAAGCAGG + Intergenic
996513761 5:124346962-124346984 AGATAATACATAAAAGAAAATGG + Intergenic
996921782 5:128776595-128776617 ATGTAATACATGTGAAAAAAGGG + Intronic
997867351 5:137476261-137476283 ATGTAAGAAATTAAAAAAGATGG + Intronic
999628255 5:153542819-153542841 ATGTGATAAATGAAAAAAAAAGG - Intronic
999649954 5:153755684-153755706 AAATAATACATAAAACAAGATGG + Intronic
1001046337 5:168374905-168374927 ATGTAAAGTATGAAAGAAAAAGG + Intronic
1001730301 5:173949006-173949028 ATGAAAGACAAGAAAGAACATGG + Intronic
1002957140 6:1877263-1877285 ATGGAAGACTTGACAGAAGAAGG - Intronic
1003219963 6:4151863-4151885 ATGTAATACATAAACGAGAAAGG - Intergenic
1003690727 6:8351302-8351324 AGGAAAGACTTGAAAGAAGATGG + Intergenic
1003779374 6:9405796-9405818 TAGCAAAACATGAAAGAAGAGGG - Intergenic
1004006309 6:11640446-11640468 ATGGAACTCATGCAAGAAGAGGG - Intergenic
1004538861 6:16529639-16529661 AGGTAATAAATGAAAAAAGTTGG - Intronic
1004650780 6:17605782-17605804 ATTTAAAACATGAAATAATATGG + Intronic
1005210292 6:23452927-23452949 ATGAAAAGAATGAAAGAAGATGG + Intergenic
1005219301 6:23567858-23567880 ATGTGTTAAATTAAAGAAGAAGG + Intergenic
1005740545 6:28786622-28786644 ATGAAATACAAGAAAGATCAGGG + Intergenic
1005916187 6:30353611-30353633 AGGTAATACATGCAAGTAGCAGG + Intergenic
1006257162 6:32841026-32841048 GTGTACCACATGAAGGAAGATGG - Exonic
1006956123 6:37873835-37873857 AGGTAATACATAAACGAATAAGG + Intronic
1007289177 6:40772190-40772212 AAGAAATAAATGAAAGAAAAAGG + Intergenic
1008011528 6:46472785-46472807 ATATAAGTCTTGAAAGAAGAAGG + Intronic
1008015173 6:46510525-46510547 ATGTGATAGATGCATGAAGAAGG - Intergenic
1008896389 6:56561264-56561286 ATGGAAGACATGAAAGAGAATGG - Intronic
1009289244 6:61864109-61864131 ATGGAAAACAGGAAAAAAGAGGG - Intronic
1009319082 6:62263262-62263284 ATGTAATTCACCAAAGAATATGG + Intronic
1009483798 6:64194499-64194521 ATGTAAGTCATGAAAGATCAAGG - Intronic
1009488152 6:64252020-64252042 ATGTAATACATTTTAGAGGATGG + Intronic
1009781492 6:68277355-68277377 ATGTAATACAGCAAAGGTGATGG + Intergenic
1010662243 6:78584597-78584619 AAGAAATACATTAATGAAGAAGG + Intergenic
1010715277 6:79221799-79221821 ATGGAAGACAAGAAAGAGGAGGG + Intronic
1011341854 6:86324685-86324707 ACTTAATAGATGAAAGATGAAGG + Intergenic
1012670512 6:102039879-102039901 AACTAATACATGAAAGAAAGAGG - Intronic
1012946287 6:105469349-105469371 TTTTAAGTCATGAAAGAAGAAGG - Intergenic
1013282640 6:108653157-108653179 ATGTCCTACATGAGTGAAGATGG - Intronic
1014229699 6:118889555-118889577 TTATAAAACATGAAGGAAGATGG + Intronic
1014570493 6:123001631-123001653 ATGCAATACATGGAGGACGAAGG - Intronic
1014605587 6:123470108-123470130 ATTTAATAAATAAAAGAATAAGG - Intronic
1014657741 6:124129237-124129259 AAATAATACAGGAAAGAAGGAGG + Intronic
1014801922 6:125788100-125788122 ATATAATACATGAAATAATTTGG - Intronic
1016520421 6:144940701-144940723 AAGAAATAAATGAAAAAAGAAGG - Intergenic
1016907181 6:149162892-149162914 ATGGAAAACATGAAATCAGATGG + Intergenic
1017661752 6:156681428-156681450 CCTTAATGCATGAAAGAAGATGG - Intergenic
1018211759 6:161489006-161489028 AAGAAAAACATGAAAGAAAAGGG + Intronic
1019036613 6:169065273-169065295 ACGTAATACCTGAAAAATGAAGG - Intergenic
1019827976 7:3300283-3300305 ATGTAAGAGATGAACGCAGAGGG - Intergenic
1023235908 7:38086793-38086815 ATATGATAAATTAAAGAAGATGG - Intergenic
1023357645 7:39383207-39383229 ACGTAATACATGTTAAAAGAAGG + Intronic
1023669195 7:42558388-42558410 AACAAATACATGAAAGAAGCTGG + Intergenic
1024424335 7:49208115-49208137 ATTTAATATATCAAAGAACAGGG - Intergenic
1024469360 7:49751340-49751362 ATTTTATGCATGGAAGAAGATGG + Intergenic
1027289373 7:76686707-76686729 ATGAATTACATGATAGAATAAGG - Intergenic
1027434833 7:78153809-78153831 ATTTAAAATATAAAAGAAGATGG - Intronic
1027807820 7:82852024-82852046 ATGGAAGAAAGGAAAGAAGAAGG + Intronic
1027878804 7:83805050-83805072 AAGCAATAGATTAAAGAAGAAGG - Intergenic
1028875647 7:95820363-95820385 AAGTAATACATGAAATAATAAGG - Intronic
1029027026 7:97427697-97427719 ATGCAGTAGATGAAAGAAGTAGG + Intergenic
1029922014 7:104275186-104275208 ATGTAATGAATCAAAGGAGATGG - Intergenic
1029954669 7:104625232-104625254 AAGCAAAACATGAAAAAAGAAGG + Intronic
1030238148 7:107290137-107290159 ATGTTACATGTGAAAGAAGAGGG - Intronic
1030511169 7:110483731-110483753 GAGTGATAGATGAAAGAAGAGGG - Intergenic
1030896706 7:115069896-115069918 ATAAAAAACATGACAGAAGAAGG - Intergenic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031316419 7:120262863-120262885 ATGTAAAATATGAAAAAAGATGG - Intergenic
1031839200 7:126716982-126717004 AGGAACTACATGAAAGATGATGG + Intronic
1032379219 7:131458648-131458670 AAGGAATCCAAGAAAGAAGATGG - Intronic
1033151629 7:138919752-138919774 ATGTCATAAATGAGAGAAAATGG - Intronic
1033674570 7:143527575-143527597 ATGTAATTCAGTCAAGAAGAAGG - Intergenic
1033697266 7:143801865-143801887 ATGTAATTCAGTCAAGAAGAAGG + Intergenic
1033777274 7:144626502-144626524 ATGATTTACATGAAAGAATAAGG + Intronic
1033900871 7:146137489-146137511 ATTTAGGACTTGAAAGAAGAAGG + Intronic
1034060769 7:148086071-148086093 ATGTAATACACAGAAGAAAAAGG + Intronic
1034331447 7:150286696-150286718 ATGTCTAACATGAAAGACGATGG - Intronic
1034485975 7:151362821-151362843 AGGTACCACATGAAAGAAGCAGG + Intronic
1034666596 7:152823165-152823187 ATGTCTAACATGAAAGACGATGG + Intronic
1034718301 7:153264051-153264073 ATGTGACACATGAAAAAAAAAGG - Intergenic
1034722761 7:153309858-153309880 CTGGAATACATGCAAGAAGCAGG + Intergenic
1036969919 8:13344096-13344118 ATGTATTGAATGAAAGAAAAAGG - Intronic
1037889683 8:22617274-22617296 ATTAAATACATGAAATGAGACGG + Intronic
1038587768 8:28805848-28805870 ACTAAAAACATGAAAGAAGATGG + Intronic
1040662813 8:49595323-49595345 ATGTACTACATAAAAGAAACTGG - Intergenic
1041094973 8:54341227-54341249 ATGTAAAACAAGAGAGAAGATGG + Intergenic
1041185556 8:55296884-55296906 ATATTATACAAGAAAGAATAAGG + Intronic
1041560466 8:59212651-59212673 ATGAAAAACATGAAAGAGCAGGG - Intergenic
1041894668 8:62909299-62909321 ATTAAATATATCAAAGAAGATGG + Intronic
1042332409 8:67594611-67594633 ATGAAATAAATGAAGCAAGAAGG - Intronic
1042824570 8:72967180-72967202 ATTTAATACATGGAAGTATATGG + Intergenic
1042935156 8:74051061-74051083 TAGTAATAGAGGAAAGAAGATGG + Intergenic
1042977866 8:74490837-74490859 ATTTAATACTTCAGAGAAGAAGG + Intergenic
1043337860 8:79199267-79199289 ATGTAATACATGAAATAATTAGG - Intergenic
1044256694 8:90071592-90071614 AAGTAACACAAGAAAGAAGAGGG + Intronic
1044547679 8:93477679-93477701 ACGTAAGACATGAGAGAAAAAGG - Intergenic
1045148572 8:99376404-99376426 ATGTTATAGATGATAAAAGAGGG - Intronic
1045180246 8:99773134-99773156 ATGTAATACTTGAAAAAGGTAGG + Intronic
1045450953 8:102324628-102324650 ATGTAAGAAACAAAAGAAGATGG + Intronic
1045582126 8:103493297-103493319 ATGCTATAAATGAAAGATGAAGG + Intergenic
1045823252 8:106366903-106366925 ATGTAATACATGAAAGAAGATGG - Intronic
1046282926 8:112057501-112057523 ATGGAAAACATAAAAGAGGAGGG - Intergenic
1046581348 8:116096666-116096688 ATTTAACACATGAAAGAAACAGG + Intergenic
1048499208 8:134960517-134960539 ATGTATTCCCTGTAAGAAGAGGG - Intergenic
1048935936 8:139357128-139357150 ATGAAATAAAGGAAAGAAAAGGG - Intergenic
1050040843 9:1491698-1491720 AGGTAATATATGAAGGAAGTAGG + Intergenic
1051221031 9:14848603-14848625 AGGGAATACAAGAAAGTAGATGG - Intronic
1051757305 9:20416921-20416943 ATGTATTACATGAACAAACATGG - Intronic
1052394904 9:27927257-27927279 ATTTAATAGATGAAGGAGGAAGG + Intergenic
1052428350 9:28334182-28334204 ATGAAATATAAGAAAGAAGATGG + Intronic
1054826598 9:69579741-69579763 ATGTTATAATTGAAATAAGATGG + Intronic
1054828933 9:69602106-69602128 AGAGAATACATGAAAAAAGAAGG - Intronic
1054873760 9:70074218-70074240 ATGTATTTCAGGCAAGAAGATGG + Intronic
1056077492 9:83056450-83056472 AAGTGATACATGAAGCAAGAAGG + Intronic
1056337226 9:85584377-85584399 AAGGAATACATGAAAGAGGAAGG - Intronic
1058260466 9:102823241-102823263 ATGAAATAAATAAAAGTAGATGG - Intergenic
1059012476 9:110477098-110477120 CTGGAATACAAGAGAGAAGAGGG - Intronic
1061910839 9:133722399-133722421 ATGTGATACTTCAAGGAAGAAGG + Intronic
1186299932 X:8189579-8189601 ATGTAATACTTGACAGATGGGGG + Intergenic
1186368086 X:8916938-8916960 ATGGCAAACATGAAATAAGATGG - Intergenic
1186421627 X:9431579-9431601 ATGTAATTCCTGAGAGAAAATGG + Intergenic
1186443703 X:9607739-9607761 AAGTAGAACATGAAAGAGGATGG + Intronic
1187078403 X:15959742-15959764 AGATAATAAATGAAAGAAGAAGG + Intergenic
1187723089 X:22172361-22172383 ATTTAATACATGAAATATGTTGG + Intronic
1188548954 X:31340586-31340608 ATGTAATACATTAAGGGAAAAGG - Intronic
1188575427 X:31644122-31644144 TTGGAATACAAAAAAGAAGATGG + Intronic
1188970497 X:36609533-36609555 ATGGAATCAATGAAGGAAGAAGG - Intergenic
1190123619 X:47684101-47684123 CTGTAATACAAGAAAGAAGTTGG + Intergenic
1191626701 X:63277953-63277975 ATGTACTACATGAAAGACGTAGG - Intergenic
1192067807 X:67904507-67904529 ATGTAAAACAGCAAAGATGATGG + Intergenic
1193051792 X:77109580-77109602 ATCAAATATATGAAAGCAGAGGG + Intergenic
1193106587 X:77681894-77681916 AAATATTCCATGAAAGAAGATGG - Exonic
1193218975 X:78899756-78899778 ATAAAATAAATGACAGAAGAAGG + Intergenic
1193342529 X:80366972-80366994 ATTTTATACATGAAAGATGTAGG + Intronic
1195196814 X:102505225-102505247 ACGTAATACATGAAACAACATGG - Intergenic
1195647041 X:107244322-107244344 ATGCAATACAGTATAGAAGAAGG - Intergenic
1195931959 X:110087469-110087491 AAGGAATACATGAAGGAAAAGGG + Intronic
1197284393 X:124578952-124578974 ATCTAATTGGTGAAAGAAGATGG - Intronic
1198218281 X:134576748-134576770 ATGTGAGACATGTAGGAAGAAGG + Intronic
1198338033 X:135687684-135687706 ATTTAATACAGGCAAGCAGAAGG + Intergenic
1198361006 X:135894680-135894702 ATTTAATACAAGCAAGCAGAAGG - Intronic
1198806551 X:140500668-140500690 ATGTAAAACAAGGAAGAGGAGGG + Intergenic
1198881323 X:141284325-141284347 ATGGCACACATGAAAGAAAAAGG - Intergenic
1199143647 X:144339379-144339401 GTTTAATAAGTGAAAGAAGAAGG + Intergenic
1199423244 X:147671312-147671334 ATGTAATACATGTGACAACAAGG + Intergenic
1200809526 Y:7468568-7468590 AGATAATACATGATAGATGATGG + Intergenic
1201416809 Y:13755198-13755220 ATGTCATACAGAAAGGAAGATGG + Intergenic
1201728597 Y:17182294-17182316 ATGCAATGCATGAAAGGAAAGGG - Intergenic
1202060250 Y:20879624-20879646 AAGTAATACATGAATTTAGAAGG + Intergenic
1202063614 Y:20914205-20914227 CTGTGATACATGGGAGAAGAGGG - Intergenic