ID: 1045823335

View in Genome Browser
Species Human (GRCh38)
Location 8:106367909-106367931
Sequence GGGGAACTGTCTAGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045823330_1045823335 6 Left 1045823330 8:106367880-106367902 CCTGAGACTGAAAAGTATCTGGT 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1045823335 8:106367909-106367931 GGGGAACTGTCTAGGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045823335 Original CRISPR GGGGAACTGTCTAGGAAGCC AGG Intronic
No off target data available for this crispr