ID: 1045825531

View in Genome Browser
Species Human (GRCh38)
Location 8:106393019-106393041
Sequence GTGGAGAAGTTGGAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1038
Summary {0: 1, 1: 0, 2: 8, 3: 87, 4: 942}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045825531_1045825536 21 Left 1045825531 8:106393019-106393041 CCATCCTTCTCCAACTTCTCCAC 0: 1
1: 0
2: 8
3: 87
4: 942
Right 1045825536 8:106393063-106393085 TTCTGAGTCACAGCTCCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045825531 Original CRISPR GTGGAGAAGTTGGAGAAGGA TGG (reversed) Intronic
900162074 1:1228582-1228604 GGGGTGAAGCTGGAGATGGACGG - Exonic
900480788 1:2898167-2898189 GTGGAGCCGTTGGAGCAGGGAGG + Intergenic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900768484 1:4521128-4521150 GTGGTGGAGGTGGAGATGGAGGG - Intergenic
901218640 1:7569680-7569702 ATGGTGATGTTGGAGAATGATGG - Intronic
901241075 1:7693821-7693843 CTGGAGGAGCTGGAGAGGGAGGG - Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901438867 1:9265422-9265444 GTGCAGAGGTTCTAGAAGGAGGG - Exonic
901740379 1:11338166-11338188 GGGGAGAAGGAGGAGAAGGGGGG - Intergenic
901751694 1:11413918-11413940 GAGGAGAAGGGGGAGAAGGAGGG - Intergenic
902219149 1:14953807-14953829 GTGGAGAAAGTGGAGAAAGGTGG + Intronic
902490546 1:16777867-16777889 GTGGAGAAGGTGGAGGGGAAGGG + Intronic
902726724 1:18341108-18341130 GAGAAGAAGAAGGAGAAGGAGGG - Intronic
903320693 1:22541506-22541528 GGGCAGAAGCTGGAGGAGGAGGG - Intergenic
903698501 1:25228161-25228183 GTGCAGAAGATGCAGAAAGATGG - Exonic
903793157 1:25908023-25908045 TTAGAAAAGTTGGAGAAGGATGG + Intergenic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904286029 1:29453801-29453823 GAGGAGGAGGAGGAGAAGGAGGG - Intergenic
904646541 1:31971821-31971843 GTGGAGAGGCTGGAAAATGAGGG + Intergenic
904901607 1:33862044-33862066 GAAGAGAGGTTGGAGAAGGCTGG + Intronic
904917493 1:33980879-33980901 GTGGGGAACTTCCAGAAGGAGGG + Intronic
904937891 1:34144755-34144777 GAGGAGAAATTGGACAAGAACGG + Intronic
905326757 1:37158465-37158487 CTGGGGAAGTGAGAGAAGGAGGG + Intergenic
906079552 1:43075732-43075754 GTGGAGGAGTGGGAGGAGGGTGG - Intergenic
906107355 1:43302775-43302797 GAGGATGAGTTGCAGAAGGAGGG + Intronic
906115631 1:43355103-43355125 TAGGACAAGATGGAGAAGGATGG - Intergenic
907284774 1:53372617-53372639 GTGGAGATGATGGTGACGGAGGG - Intergenic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
909681092 1:78293188-78293210 GAGGAGAAGGAGGAAAAGGAAGG - Intergenic
910256529 1:85253590-85253612 ATGGAGAATTTGGAGAGGGGAGG + Intronic
910278739 1:85475323-85475345 GAGGAGAAGGGGGAGGAGGAGGG + Intronic
911529522 1:99028139-99028161 GTGAAGAATCTTGAGAAGGAAGG - Intergenic
911636204 1:100238450-100238472 GAGGAGGAGAAGGAGAAGGAAGG - Intronic
911700914 1:100950894-100950916 GTGGAGAAGTGAGACAGGGAAGG + Intronic
912141257 1:106731087-106731109 GAGGAGGAGTTGGTGGAGGAAGG + Intergenic
912328038 1:108787407-108787429 GTGGAAAAGAGGGATAAGGAAGG - Intronic
912906360 1:113712045-113712067 GTGAAGAAGATGGTGAAGCACGG - Exonic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913052713 1:115131165-115131187 GTGGAGATGGTGGAGAGGGGTGG + Intergenic
913186014 1:116371995-116372017 CTGGAAAAAATGGAGAAGGAAGG - Intergenic
913387915 1:118279861-118279883 GTGAAAAAGTTGGAGACTGAGGG + Intergenic
913488686 1:119357775-119357797 AGGAAGAAGTTGGAGAAGGATGG + Intergenic
913650908 1:120913174-120913196 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
913692552 1:121293120-121293142 ATGGAGAAGTTGTAGAAAGAAGG + Intronic
914043844 1:144076383-144076405 GTGGAGATGGGGTAGAAGGACGG - Intergenic
914134244 1:144884108-144884130 GTGGAGATGGGGTAGAAGGACGG + Intergenic
914145004 1:144986974-144986996 ATGGAGAAGTTGTAGAAAGAAGG - Intronic
914525322 1:148459859-148459881 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
914598351 1:149175971-149175993 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914641078 1:149607269-149607291 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914964655 1:152244181-152244203 ATGGAGAAGAAGGAGAAGGGAGG - Intergenic
915128243 1:153680216-153680238 GAGCTGAAGGTGGAGAAGGATGG - Intronic
915472896 1:156136380-156136402 GTGGAGGAGGTGGATGAGGAGGG + Exonic
915550744 1:156632304-156632326 GTGGAGAAGTGGGACAGGAAAGG + Intergenic
915835945 1:159174728-159174750 GTGGGGAAATGTGAGAAGGAAGG - Intronic
915838357 1:159196218-159196240 CATGAGAAGTAGGAGAAGGAAGG + Intronic
915935412 1:160087707-160087729 GATGAGAAGGTGGAGGAGGAGGG + Exonic
915948879 1:160174434-160174456 CAGGAGGAGTGGGAGAAGGACGG + Intronic
916323341 1:163530419-163530441 ATGGAGAAGAAGGGGAAGGAAGG - Intergenic
916620201 1:166488792-166488814 GTGGGGAAGTTGGAAGAGGATGG - Intergenic
917294266 1:173502600-173502622 TTAGAGAAGTTTGAGAAGGCTGG - Intronic
918068119 1:181115359-181115381 GTGGTGAAGCTGGGGAAGAAAGG + Intergenic
918123063 1:181556703-181556725 GGGAAGAAGTTGGGGCAGGAGGG + Intronic
918471394 1:184878927-184878949 GAGGGGAAGTTGGGGAGGGAAGG + Intronic
918715092 1:187776027-187776049 GTGGATGAGTTGGACAAAGAGGG - Intergenic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
919020632 1:192100873-192100895 GTGTAAGAGTTGAAGAAGGAAGG + Intergenic
919486117 1:198149339-198149361 GTGGAGAGGGAGGAGTAGGAAGG + Intergenic
919733395 1:200928840-200928862 GTGGGGAGGTTGGAGAGGGATGG + Intergenic
919751725 1:201041884-201041906 GTGGCCAAGATGGAGAAGCAGGG - Intronic
919769926 1:201151457-201151479 GTAGAGAAGTTGGCAAAGGTAGG - Intronic
920073721 1:203321788-203321810 GGGGAGAAGTGGGAGAAGAGGGG - Intergenic
920275252 1:204799697-204799719 ATAGAGAGGTGGGAGAAGGAGGG - Intergenic
920387467 1:205579110-205579132 GTGCAGAAGTGGGGAAAGGAGGG - Intronic
920479871 1:206311477-206311499 ATGGAGAAGTTGTAGAAAGAAGG + Intronic
920536256 1:206738518-206738540 GTGAACCTGTTGGAGAAGGAAGG - Intergenic
920673761 1:208024624-208024646 GTGGAGAGCGTGGAGAATGATGG - Exonic
920900186 1:210102409-210102431 TTTGAGAAGGTGGAGAAAGAAGG - Intronic
921336971 1:214097910-214097932 CTGGAGAAGTTGCAGAAAAAAGG + Intergenic
921342165 1:214145026-214145048 ATGGAGATGATGGAGATGGATGG + Intergenic
921517531 1:216115054-216115076 GTTGATAATTTGGAGAGGGATGG - Intronic
921592135 1:217016517-217016539 TAGTAGAAGTTGGAGAATGAAGG - Intronic
921726580 1:218531061-218531083 GTGTGGAAGTTGTAGAAGGAAGG - Intergenic
921801112 1:219403455-219403477 GTGGAGGAGAGGGAGAAGCAGGG + Intergenic
922213277 1:223501245-223501267 GAGGAGAAGGAGGAGTAGGAGGG - Intergenic
922784805 1:228277540-228277562 GTGGAAGTGATGGAGAAGGACGG + Exonic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923318082 1:232801213-232801235 GGGGAGAGGGTGGAGAAGGAGGG - Intergenic
923425586 1:233865700-233865722 CTGGAGGGCTTGGAGAAGGATGG - Intergenic
923529894 1:234804663-234804685 GTGGAGAAGGTGGAGGGGAAGGG - Intergenic
923658539 1:235939120-235939142 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
923827397 1:237515700-237515722 GAAGAGAAGAAGGAGAAGGAGGG - Intronic
923982023 1:239335776-239335798 GTAGAGAAGGAGGAGAGGGAAGG + Intergenic
924235424 1:241996062-241996084 GTGGAGGAGTCTGAGAAGCAGGG - Exonic
924327309 1:242908926-242908948 GAGGAGGAGGAGGAGAAGGAGGG - Intergenic
924499813 1:244626724-244626746 GTGAAGAAGCTGCAGAAGGAAGG - Intronic
924574282 1:245265375-245265397 GTGGACAAGTGGGAGAAGGAAGG + Intronic
1062913620 10:1230754-1230776 CTGGAGAGCGTGGAGAAGGAAGG - Intronic
1063092169 10:2875026-2875048 GAGCAGAAGATAGAGAAGGACGG - Intergenic
1063500931 10:6553610-6553632 GTGGAGGAGAAGGAGGAGGAAGG - Intronic
1064844112 10:19632260-19632282 GTGAAGAAGTTGGAGCAAGCAGG + Intronic
1065161753 10:22929409-22929431 GTGGAGAATTTGGAAAACAAGGG - Intronic
1065176813 10:23085041-23085063 GGGGAGCAGTGGGAGAAGGCAGG + Intergenic
1065297330 10:24289437-24289459 GAGGAGAAGGTGGAGGAGGAGGG + Intronic
1065326633 10:24555414-24555436 CAGGAGAAGTGGGAGAAGCAGGG - Intergenic
1066120624 10:32282789-32282811 GTGGAGAAGATGGAGATTGATGG + Intronic
1066195347 10:33093683-33093705 GTGGAGATGTAGGAGAAGTAGGG - Intergenic
1066434798 10:35387463-35387485 GGGCAGATGTGGGAGAAGGATGG + Intronic
1066556603 10:36621270-36621292 AATGAGGAGTTGGAGAAGGAAGG - Intergenic
1067196684 10:44125960-44125982 CTGGAGGAGATGGGGAAGGAGGG + Intergenic
1067285487 10:44904744-44904766 CTGGAGGAGAAGGAGAAGGATGG + Intergenic
1067709675 10:48637889-48637911 GTGGAAAAGGGGGAGAAAGAAGG - Intronic
1067973432 10:50996608-50996630 CTAGAGAAGTTGGATGAGGAAGG - Intronic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1069977624 10:72227254-72227276 GTGGAGATATTGAAGAAGAAAGG + Intronic
1070126531 10:73626375-73626397 GCGGAGTAGTTGGAGACAGAGGG + Intergenic
1070333922 10:75438009-75438031 GTGGAGGAGAGGGAGAAGAAGGG + Intronic
1070648437 10:78217880-78217902 GTGGGGAAGTGAGACAAGGAAGG - Intergenic
1070661228 10:78306780-78306802 GTGGAAAAGAGGGTGAAGGAAGG + Intergenic
1071515470 10:86294081-86294103 GTGTAGAAGCTGGAGGAGTATGG + Intronic
1071839174 10:89451261-89451283 GTGAAGAGCTTGGAGAAGAAGGG + Intronic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1072301674 10:94067878-94067900 TTGGAGCAGGTGGAGAAGGGAGG + Intronic
1072563150 10:96595591-96595613 GTGGAACAGGTGGAGGAGGATGG + Exonic
1072603898 10:96961042-96961064 GTGGGGAGGGTGGAGTAGGATGG + Intronic
1072801414 10:98394798-98394820 GTGGAGAGGTAGAAGAGGGAAGG + Intronic
1073064773 10:100751460-100751482 GTAGAGGAGCTGGACAAGGAGGG + Intronic
1073757805 10:106599382-106599404 GAGGAGGAGGAGGAGAAGGAAGG + Intronic
1075319133 10:121475942-121475964 GTGAAGAAGTTGGACAAAAAAGG + Intergenic
1076312260 10:129517057-129517079 CTGGAGAAGCTGGAGTGGGAGGG - Intronic
1076931404 10:133534263-133534285 GTGGGGAGGTTGGAGCTGGAGGG + Intronic
1077473959 11:2777743-2777765 GTGGAGAGCGTGGAGCAGGATGG + Intronic
1077557228 11:3231546-3231568 GAGGAGAGGGAGGAGAAGGAGGG + Intronic
1077661750 11:4074662-4074684 GAGGAGGAGTTGGAGCAGGTAGG + Exonic
1077701102 11:4443476-4443498 GAGGGGAGGGTGGAGAAGGAAGG + Intergenic
1077825269 11:5801127-5801149 GTGAAGAAGTTGAAAAAGGCTGG - Intronic
1077834346 11:5911399-5911421 TTGAAGAATTTGGAGAAGCAAGG - Intronic
1078366404 11:10710188-10710210 GAGGAGGAGTGGGGGAAGGAAGG + Intergenic
1078510032 11:11978175-11978197 CAGGAGAAGGTTGAGAAGGAAGG + Intronic
1078580548 11:12536415-12536437 GTCAAGATGCTGGAGAAGGAGGG - Intergenic
1078662929 11:13301651-13301673 GTAGAGGAGATGGAGATGGAAGG + Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079930921 11:26559303-26559325 GTGGGGAAGTTGGAAAATGCAGG - Exonic
1080074067 11:28127239-28127261 GTTGAGACATTGGAGAAGAATGG + Intronic
1080290551 11:30666065-30666087 AAGGAGAAGGGGGAGAAGGAGGG + Intergenic
1080827592 11:35861177-35861199 TGGGAGCAGTTGGAGAAGAAGGG - Intergenic
1080895766 11:36447833-36447855 ATGGAAGAGATGGAGAAGGAGGG + Intronic
1081385945 11:42473358-42473380 GTGTAGAATTAGGATAAGGAGGG + Intergenic
1081391922 11:42539591-42539613 GTGGGGAAGTGGGACAGGGAAGG + Intergenic
1081975350 11:47230764-47230786 GTGGAAAAGGTGGAGAAAGGCGG + Intronic
1082203115 11:49397910-49397932 GTTGAGGAGTGGGAGGAGGATGG - Intergenic
1082771053 11:57207596-57207618 GTAGAGAAGTAGCAGGAGGAAGG - Intergenic
1082784942 11:57311596-57311618 GGGGAGAAGGAGGAGCAGGAAGG - Intronic
1082878421 11:58012842-58012864 GTGGAGAAGTTGTTCAAGGTAGG + Intergenic
1082975435 11:59065835-59065857 GTGGATAAGATGGAGAAACAAGG - Intergenic
1083266722 11:61550356-61550378 GTGGAGAAATAGGAAAGGGAAGG + Intronic
1083337382 11:61931637-61931659 GAGGAGGAGGAGGAGAAGGAAGG + Intergenic
1083372221 11:62191196-62191218 GGGGAGAATTTGGAGAGGGTAGG - Intronic
1083728268 11:64639781-64639803 GTGGAGAAGCTGGTGCAGAAAGG + Intronic
1084295501 11:68211245-68211267 GTGGGGAAGGTGGAGGTGGATGG - Intronic
1084617543 11:70246471-70246493 GTGGGAAAGCTGGGGAAGGAGGG + Intergenic
1084729915 11:71066238-71066260 GTGGGGAAGTTGGCGGGGGAGGG + Intronic
1084880934 11:72171436-72171458 ATTGTGAAGTGGGAGAAGGAAGG - Intergenic
1084919605 11:72458364-72458386 GTGGGGAAGGAAGAGAAGGAAGG + Intergenic
1085015744 11:73173164-73173186 TTGGAGAACTTGGAGAGGAAAGG + Intergenic
1085040495 11:73323781-73323803 GTGGAGGAATAGGAGAAGGGTGG + Intronic
1085553249 11:77395006-77395028 TTGAAGAAGTTGGAGAAGTTGGG - Intronic
1086069655 11:82786793-82786815 GTGGAGAGGGTAGAGGAGGAGGG - Intergenic
1086651924 11:89302169-89302191 GTGGAGGAGTGGGAGGAGGATGG + Intergenic
1087080640 11:94168022-94168044 GTGGAGAAGTGGGAGGCAGATGG + Intronic
1087105571 11:94403597-94403619 GTGGAGAAGTGTGACAAGAAAGG + Intergenic
1088629878 11:111764760-111764782 CTGCAAAAGTTGTAGAAGGAGGG + Intronic
1088799604 11:113293499-113293521 GGGGAGGAGTTGGAGGAGGAGGG - Intergenic
1089310629 11:117555965-117555987 GAAGAGAAGGTGGAGGAGGAGGG + Intronic
1089316985 11:117598688-117598710 GTGGAGAAGGGGTTGAAGGAGGG + Intronic
1089659776 11:119978311-119978333 ATGGAGAAGGTGGTGAAGGAGGG + Intergenic
1089745530 11:120614290-120614312 GTGGAGAAGTGAGACAGGGAAGG + Intronic
1090569525 11:128031154-128031176 GAGGAGGAGGAGGAGAAGGAAGG + Intergenic
1090872668 11:130762121-130762143 TTGGAGCAGTTGGAGAAGGAGGG - Intergenic
1090905963 11:131074743-131074765 GTGGAGAAGTGGGAGAAATAGGG - Intergenic
1091148043 11:133297966-133297988 GATGAGAAATTGGAGAAAGAAGG - Intronic
1091693200 12:2610912-2610934 GGGGAGGAGATGGAGAAGGGAGG + Intronic
1091693236 12:2611107-2611129 GGGGAGGAGATGGAGAAGGGAGG + Intronic
1091693250 12:2611172-2611194 GGGGAGGAGATGGAGAAGGGAGG + Intronic
1091693263 12:2611237-2611259 GGGGAGGAGATGGAGAAGGGAGG + Intronic
1091693302 12:2611430-2611452 GGGGAGGAGATGGAGAAGGGAGG + Intronic
1091693309 12:2611451-2611473 GGGGAGGAGATGGAGAAGGGAGG + Intronic
1091693323 12:2611516-2611538 GGGGAGGAGATGGAGAAGGGAGG + Intronic
1092361387 12:7839614-7839636 ATGGAGAAGATGCTGAAGGAGGG + Intronic
1092375831 12:7954878-7954900 ATGGAGAAGATGCTGAAGGAGGG + Intergenic
1092882734 12:12900568-12900590 GTGGGGAAGAGGGAGAGGGAAGG - Intronic
1092993541 12:13926499-13926521 CTGGAGAAACTGGGGAAGGAGGG - Intronic
1094085573 12:26587732-26587754 GTGGAGGAGATGGAGGAGAAAGG - Intronic
1094177692 12:27558572-27558594 GTGGAGAGGTGGGGGCAGGAAGG - Intronic
1094512809 12:31106320-31106342 GAGCAGAAGGTGGAGAGGGAGGG - Intergenic
1096185462 12:49577670-49577692 GTGGAGAATTTAAAGAAGAATGG - Intronic
1096316418 12:50571101-50571123 GTGGAGGGGTTGGGGAAGGATGG + Intronic
1096447751 12:51709474-51709496 GTAGCGATGTTGGAGAAGGCAGG + Intronic
1096590614 12:52656668-52656690 ATGGAGAAGTTGGGTAAGAAGGG - Intergenic
1096616961 12:52838753-52838775 GTGGAGTTGTGGGAGATGGAGGG + Intronic
1096618784 12:52849412-52849434 CTCAAGGAGTTGGAGAAGGAAGG + Intergenic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096784914 12:54011307-54011329 GAGGAGAAGGTGGAGGAAGAAGG + Exonic
1096886155 12:54721334-54721356 GAGGAGGAGTGGCAGAAGGAGGG - Intergenic
1096886179 12:54721418-54721440 GAGGAGGAGTGTGAGAAGGAGGG - Intergenic
1097151055 12:56980181-56980203 GAGGAGAGGATGGAGAAAGATGG - Intergenic
1097173806 12:57131333-57131355 CTGGAGAGGTTGCAGAAAGATGG + Intronic
1097177273 12:57150645-57150667 GTGGAAAAGGTGGGAAAGGATGG + Intronic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098345602 12:69499775-69499797 ATGGTGAAGTTGGAGTAGGGTGG + Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099051402 12:77785468-77785490 GTGAAGAAGTAGGAGGAGGGAGG + Intergenic
1099614643 12:84919055-84919077 GAGAAGTAGATGGAGAAGGAAGG - Intergenic
1099712813 12:86248693-86248715 GTGGCGAAGTTACATAAGGATGG - Intronic
1099940520 12:89182705-89182727 GTGACCAGGTTGGAGAAGGAAGG - Intergenic
1100677657 12:96885852-96885874 GGGGAGAAGGAGGAGGAGGAAGG - Intergenic
1100985550 12:100199378-100199400 GTGGAGAAGTGGGGAAAGGCAGG + Intronic
1101447918 12:104751033-104751055 GTGGAGAAGAAGGAAATGGAGGG + Intronic
1101559792 12:105845604-105845626 GAGGTGAAGGAGGAGAAGGAGGG - Intergenic
1101782751 12:107850059-107850081 GTGGAGAAGAAGGAGGAGCAGGG - Intergenic
1101925971 12:108971663-108971685 GTGGAGAAGTGAGACAGGGAAGG + Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102243218 12:111338453-111338475 ATGAAGAAGCTGGAGAAGAAAGG + Exonic
1102652415 12:114451543-114451565 CTGGAGAAGTTGGAGTAGTCAGG + Intergenic
1102682756 12:114701822-114701844 GTGGAGATGGTGGAAAAGGCAGG - Intergenic
1102887670 12:116534065-116534087 GGGGAGAAGGAGGAGGAGGAGGG - Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103080936 12:118023457-118023479 GAGGAGAAGGCGGAGGAGGAGGG + Intronic
1103199142 12:119072357-119072379 GGGGAGAAGGTAGGGAAGGAAGG - Intronic
1103682107 12:122702367-122702389 GAGAAGAAGTTGGGAAAGGATGG + Exonic
1103683850 12:122715821-122715843 GAGAAGAAGTTGGGAAAGGATGG + Exonic
1105544856 13:21343963-21343985 AGGGAGGAGATGGAGAAGGAGGG - Intergenic
1105544860 13:21343979-21344001 GAGGAGAAGAAGGAGAAGGGAGG - Intergenic
1106156073 13:27157779-27157801 CTGCATCAGTTGGAGAAGGAAGG - Intronic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106736607 13:32593786-32593808 GAGGAGAAGGAGGAAAAGGAAGG + Intronic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107731057 13:43349497-43349519 GTGGAAGAGAGGGAGAAGGAAGG - Intronic
1108304030 13:49113064-49113086 GTGGAGAAATAGGAGAAAGGGGG - Intronic
1108618762 13:52160507-52160529 GAGGAGAAGCTAGAAAAGGAGGG + Intergenic
1108650204 13:52470779-52470801 GTGAAGGAGCTTGAGAAGGAGGG + Intronic
1108678876 13:52762447-52762469 ATGGTGAAGTTGGGGGAGGAAGG + Intergenic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1108819784 13:54334562-54334584 GTGGAGAAGGTACAAAAGGAGGG + Intergenic
1109977672 13:69861282-69861304 GTGGAGAATTTAAAGAGGGAAGG - Intronic
1110080999 13:71311622-71311644 GTGGAGAAAAGGGTGAAGGAGGG + Intergenic
1110398527 13:75062625-75062647 GAGAAGAAGGAGGAGAAGGAAGG + Intergenic
1110610953 13:77487008-77487030 GTGGAGAATTTGAAGAAGATAGG + Intergenic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1110871673 13:80459627-80459649 GTGCAGAGCTTGGAGAAGGCAGG - Intergenic
1111256330 13:85673987-85674009 GTGGAGAAGGGAGAGAGGGATGG + Intergenic
1111276599 13:85956100-85956122 GCTGAGAAGTAGGAAAAGGAGGG + Intergenic
1111621096 13:90726966-90726988 GTGGAGAAGATGGAGGAAAATGG + Intergenic
1111957054 13:94770825-94770847 GTGAAGAAGGTGGGGAGGGAGGG + Intergenic
1111993133 13:95136739-95136761 GTGGACACGCTGGGGAAGGACGG + Intronic
1112229988 13:97580313-97580335 GAAGGGAAGCTGGAGAAGGAAGG - Intergenic
1112294266 13:98172653-98172675 GTGGAGAAGCTGGAGAGAGAAGG + Intronic
1112548180 13:100392188-100392210 GTAGAGGAGTTGGGGAAGGAAGG + Intronic
1114288402 14:21267580-21267602 GGGGAAAAGTTGAAGAAGGATGG - Intronic
1114567185 14:23641357-23641379 CTGGAGTCGCTGGAGAAGGATGG - Intronic
1114597112 14:23922607-23922629 GTTTAGAAGTTGGAGATAGAAGG + Intergenic
1115095235 14:29627364-29627386 CTGGAGAGGCTGCAGAAGGATGG + Intronic
1115208113 14:30935188-30935210 GTGAAGGAGCTGGAGAAGCACGG - Exonic
1115298130 14:31853447-31853469 ATGGAGAAGGTGGAGTAAGAAGG - Intronic
1115475170 14:33806347-33806369 GTCTAGGAGTAGGAGAAGGACGG - Intergenic
1115861058 14:37686960-37686982 CTGGAGAAGGTGGAGCAAGATGG + Intronic
1116416985 14:44689853-44689875 GAGGAGGAGGGGGAGAAGGAGGG + Intergenic
1116786731 14:49296380-49296402 GTGGGGAAGTTGGACAGGAAAGG - Intergenic
1117084570 14:52186109-52186131 GAGGGGAAAGTGGAGAAGGAGGG - Intergenic
1117187092 14:53251020-53251042 GAGGAGCAGGAGGAGAAGGAGGG - Intergenic
1117273695 14:54170727-54170749 CTGGATGAGTTGGAGATGGATGG - Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117634785 14:57730289-57730311 GATGAGAAGATGGAGAAAGATGG - Intronic
1118459528 14:65975954-65975976 GAGGAGAGGGAGGAGAAGGAGGG + Intronic
1118749168 14:68794141-68794163 GTGGGGAGGATGGAGGAGGAGGG - Intronic
1118766768 14:68915264-68915286 GAGGAGGAGGAGGAGAAGGAGGG - Intronic
1118900441 14:69981213-69981235 GGGAAGAAGTGGGGGAAGGAGGG + Intronic
1119071869 14:71594057-71594079 ATGGAGGAGGAGGAGAAGGAAGG - Intronic
1119377453 14:74206355-74206377 GGGGAGGAGTGGGGGAAGGAGGG - Intergenic
1119749625 14:77068163-77068185 TTGGAGAATCTGGAGAAGGGTGG - Intergenic
1120848454 14:89147220-89147242 GTGGAGAAGTTGAACACAGAGGG + Intronic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121249327 14:92488042-92488064 GAGGAGGAGGAGGAGAAGGATGG - Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121717507 14:96086850-96086872 GGGGAGAAATTCCAGAAGGACGG - Exonic
1122160745 14:99782139-99782161 GTGGAGGGGTTGGGGAAGGAAGG - Intronic
1122323204 14:100867740-100867762 GGGGGGGAGGTGGAGAAGGATGG - Intergenic
1122355286 14:101119524-101119546 ATGGATATGTTCGAGAAGGATGG - Intergenic
1122449921 14:101797480-101797502 ATGGAGAGGGTGGAGAAAGAGGG - Intronic
1122886934 14:104714343-104714365 CTGGAGCAGTTGGAGGAGGGTGG + Exonic
1123711377 15:22990225-22990247 GGGGAGGAGTGGGAGAAGGAGGG - Intronic
1124012420 15:25849488-25849510 TTGGAGAAGGCGTAGAAGGAGGG - Intronic
1124708743 15:31987220-31987242 GGGAAGAGTTTGGAGAAGGAAGG - Intergenic
1124862750 15:33458986-33459008 CTGGGGAAGTTAGAGAAGGTTGG - Intronic
1125147882 15:36493648-36493670 GTGCAGAAGTTTGAGATGGCTGG - Intergenic
1125270717 15:37935815-37935837 GTGTTGAGGTGGGAGAAGGAAGG + Intronic
1125316120 15:38433378-38433400 GTGCACAAGGTGGAGAATGATGG + Intergenic
1125466549 15:39958787-39958809 GTGTAGATGTTGGGGCAGGAGGG - Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1127363369 15:58264663-58264685 AGGGAGAAGAGGGAGAAGGAGGG - Intronic
1127604829 15:60576035-60576057 GTGGTGATGTGGGGGAAGGATGG - Intronic
1127845373 15:62866082-62866104 GTGGAGAAGGTGGATGAGGTTGG + Intergenic
1128146803 15:65336523-65336545 TGGGAGGAGTAGGAGAAGGAGGG - Intronic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128371264 15:67041168-67041190 GGAGAGAAGGTAGAGAAGGAAGG + Intergenic
1128544081 15:68555739-68555761 GTGGAGAACTCGGAGAAGTCTGG + Intergenic
1128783360 15:70377421-70377443 GAGGGGAGGTTGGAGGAGGAAGG - Intergenic
1129465750 15:75723366-75723388 GGGGAGCAGTTGGAGTTGGAGGG - Intergenic
1129932603 15:79424876-79424898 GTGGAGAAGAAATAGAAGGAAGG + Intronic
1130018449 15:80205705-80205727 GTGGAAAAGTTGGACTAGGAAGG - Intergenic
1130175914 15:81570627-81570649 TTGGAGAAGGTGGGGAAAGAAGG - Intergenic
1130266057 15:82404660-82404682 GAGAAGAAGTTGGAGGATGAAGG + Intergenic
1130336098 15:82958516-82958538 GTGGAGATTTTGAAGTAGGAGGG + Intronic
1130420088 15:83736828-83736850 GTGGAGAAGTGGGAGGACTATGG - Intronic
1130505958 15:84542214-84542236 GAGAAGAAGTTGGAGGATGAAGG - Intergenic
1130972026 15:88741196-88741218 GTGGAGAAACTGTGGAAGGATGG + Intergenic
1131139862 15:89968233-89968255 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1131229048 15:90647095-90647117 GAGGAGGGGTTGGAGGAGGAGGG - Intergenic
1131269083 15:90935553-90935575 GTGGAGCAGCTGCGGAAGGAGGG + Exonic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131473309 15:92714739-92714761 GAGGAGCCGCTGGAGAAGGAAGG - Intronic
1131744756 15:95435261-95435283 GTGGAGATGTTTGAGAAAGAAGG - Intergenic
1132202561 15:99964917-99964939 GTGGAGAAGTTCCAGCAGAACGG + Intergenic
1132324777 15:100959484-100959506 GAGGAGAATTTCGAGAAGCATGG + Intronic
1132482926 16:175574-175596 GTGGAGGAGGTGGAGGAGGGAGG - Intergenic
1132839809 16:1973529-1973551 GTGGAGGCAGTGGAGAAGGAAGG + Intronic
1133392625 16:5422328-5422350 GAGGAGAACGTGGAGGAGGAGGG + Intergenic
1133485379 16:6214573-6214595 GAGGCAAAGTGGGAGAAGGAGGG + Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133971285 16:10570011-10570033 GGGGAGGAGTGGGAGAAGGGAGG - Intronic
1134261042 16:12651021-12651043 GTGGAAAATTGAGAGAAGGAGGG + Intergenic
1134863568 16:17583988-17584010 ATGGAGAATTGGGAGATGGAAGG - Intergenic
1135478174 16:22796536-22796558 GGGGAGAAGTGGGATAAAGAGGG - Intergenic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1135822542 16:25696795-25696817 GGGGAGAGAATGGAGAAGGATGG + Intronic
1137328960 16:47471175-47471197 GTGGAGAAGTTGGGGTAAGGAGG + Intronic
1137557019 16:49477215-49477237 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1137801000 16:51262090-51262112 GGGGAGAAGGAAGAGAAGGAGGG - Intergenic
1137905860 16:52321290-52321312 GTGCTGAAGGTGGAGAAGCAGGG + Intergenic
1138046083 16:53726817-53726839 GTGCAGCAGTTGGAGCAGGTTGG + Intronic
1138108990 16:54308256-54308278 GTGAAGGGGTTGGACAAGGAGGG + Intergenic
1138112693 16:54337224-54337246 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138480621 16:57300699-57300721 GTGGAGAGATGGGACAAGGAAGG + Intergenic
1139165756 16:64563332-64563354 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
1139268241 16:65659430-65659452 ATGGAGAAGGTGCAGAGGGATGG + Intergenic
1139424939 16:66873728-66873750 GAGGAGAAGGAGGAGAAGGGAGG - Intergenic
1139425012 16:66873917-66873939 GAGGAGAAGGAGGAGAAGGGAGG - Intergenic
1140037355 16:71381573-71381595 GTGGAGAAGTGGGGGGAGGCAGG + Intronic
1140357603 16:74319584-74319606 GAGGAGAAGAAGGAGAAGAAAGG - Intergenic
1140663400 16:77208921-77208943 GGGGAGAAGCTGGATCAGGATGG + Intronic
1140719569 16:77759052-77759074 GCTGAGAGGGTGGAGAAGGAAGG - Intergenic
1141044596 16:80704931-80704953 GTGGAGAAGTTGGCCAAGGTAGG + Intronic
1141372423 16:83500435-83500457 GCGGAGGAGGGGGAGAAGGAGGG - Intronic
1141787272 16:86209995-86210017 GGGGAGAGGTGGGAGAATGAGGG - Intergenic
1142254331 16:89006718-89006740 GGGGAGGAGATGGAGGAGGAGGG - Intergenic
1142254356 16:89006779-89006801 GGGGAGGAGATGGAGGAGGAGGG - Intergenic
1142592344 17:1011923-1011945 GTGGAGGAGGTGGAGAAGAGGGG - Exonic
1142762912 17:2051815-2051837 GCAGAGAAGTTGGGGAAGGTGGG + Intergenic
1143125562 17:4639342-4639364 GTGGAGAAGAGGGCGCAGGATGG - Intronic
1143245649 17:5483514-5483536 GTGGAGATGTTGGGTAGGGAAGG - Intronic
1143270030 17:5668597-5668619 GAGGAGAAGTAAGAGGAGGAGGG - Intergenic
1143402914 17:6657470-6657492 GTGGAGAAGAGGGCGCAGGATGG + Intergenic
1143460968 17:7103086-7103108 GTGGAGAAAGTGGAGAGGGATGG + Intronic
1143705072 17:8691802-8691824 GTGGAGGAATGGGAAAAGGAGGG - Intergenic
1143794718 17:9327364-9327386 AGGGAGAAGGAGGAGAAGGAGGG + Intronic
1143857574 17:9863618-9863640 GTGGAAAAGATGGCGAGGGAAGG - Intronic
1144285754 17:13772344-13772366 GTGGGGAAGTAAGAGGAGGAAGG + Intergenic
1144353191 17:14418997-14419019 ATTTAGAAGTTGGACAAGGAAGG + Intergenic
1144356420 17:14451157-14451179 GTGCAGGACTTGGAGAAGCATGG + Intergenic
1144359501 17:14478379-14478401 GAGGAGAAGGTGGTGAAAGAGGG - Intergenic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1144847280 17:18226472-18226494 CTGGAGCAGTGGGGGAAGGAAGG - Intronic
1145058492 17:19718049-19718071 GTGGAGAAGGTGTTGGAGGAGGG - Intronic
1145786505 17:27597310-27597332 GTGGAGGAGGTGGTGGAGGAAGG - Exonic
1145894461 17:28445859-28445881 GTTGAGAGGTGGGAGGAGGAGGG - Intergenic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1146656298 17:34637154-34637176 CTGGAGGAGAAGGAGAAGGAGGG - Intronic
1147376304 17:40024129-40024151 GTGGAGAAATGAGAGAAGAAAGG + Intronic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147555112 17:41473723-41473745 GTCGTGAAGATGGAGAAGTAGGG + Intergenic
1147621593 17:41871726-41871748 GTGAACAAGATGAAGAAGGAAGG - Exonic
1147635594 17:41961993-41962015 GGAGAGAAGTGGGAGAAGAAAGG + Intronic
1148017715 17:44534086-44534108 CTGGAGAAGTTGGAATAGGATGG - Intergenic
1148126798 17:45241487-45241509 GTGGAGGAGCTGGAGGAGAAGGG + Exonic
1148186146 17:45645344-45645366 GTGGATAAGATGGAGAAATAAGG - Intergenic
1148198135 17:45729456-45729478 GTGGAGAGGTGGGGGAAGGGAGG + Intergenic
1148681883 17:49478878-49478900 GTGGAGAAGGCGGAGAAGGCAGG + Intergenic
1149073125 17:52567303-52567325 CTGGAGCAGTTGTAGAATGACGG - Intergenic
1149200757 17:54183353-54183375 GTGCAGAAGCTGGAGTGGGATGG - Intergenic
1149754343 17:59174954-59174976 CTGGAGTAGTTGGAGGAGGTAGG - Intronic
1150565181 17:66332571-66332593 GTGGAGAAGCTGCAGAGGGAGGG + Intronic
1150605573 17:66687781-66687803 GTAGAGAAGGGGAAGAAGGAAGG + Intronic
1150810365 17:68351645-68351667 GTGGACACGCTGGACAAGGAGGG - Exonic
1150888885 17:69121589-69121611 GTGGGGATGTGGGAGAAGAAGGG + Intronic
1152003494 17:77662218-77662240 GTGGAGGAAGGGGAGAAGGAAGG - Intergenic
1152011667 17:77722685-77722707 GCTGAGAAGGAGGAGAAGGAGGG - Intergenic
1152055582 17:78023400-78023422 GAGGAGGAGCAGGAGAAGGAAGG - Intronic
1152277624 17:79367345-79367367 GAGGAGGAGTAGGAGGAGGAGGG - Intronic
1152368320 17:79870220-79870242 GAGGGGAAGTGGGAGGAGGAAGG - Intergenic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1152756526 17:82089344-82089366 GTGGAGCAGCTGAGGAAGGAGGG - Exonic
1153500606 18:5745651-5745673 TTGGAGAACTTGGTGAAGGCAGG - Intergenic
1153565103 18:6411557-6411579 GTGGAGAAGTAAGGGAGGGAAGG - Intronic
1153633191 18:7091550-7091572 GTGCAGAAGTGGCAGAAGAAAGG - Intronic
1154089943 18:11348970-11348992 GTAGAGGAGTTGGATAAAGATGG + Intergenic
1155263182 18:24065091-24065113 GTGGAGGAGGAGGAGAAGCAAGG + Intronic
1155406674 18:25496208-25496230 TGGGAGAATGTGGAGAAGGAGGG + Intergenic
1155425222 18:25700022-25700044 CTGGAGAAGCTGGAGAAGCCAGG - Intergenic
1155756249 18:29500349-29500371 GAGGAGAAGGAGGAAAAGGAGGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156398572 18:36720692-36720714 GAGGAGGAGGAGGAGAAGGAGGG - Intronic
1157210073 18:45734747-45734769 GAGGAGGAGGAGGAGAAGGATGG + Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157404861 18:47414266-47414288 GTGTGGAGGTTGGAGAAGGAGGG + Intergenic
1157492605 18:48135007-48135029 GAGGAGGAGAGGGAGAAGGAAGG - Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157610573 18:48952423-48952445 ATGGAGAAATTGGAAAAGCAGGG + Intergenic
1158382519 18:56948989-56949011 GTGGAGAAGATGCAGAGAGAAGG - Intronic
1158420313 18:57287351-57287373 TTGGAGAAGATGGAGTAGGAGGG - Intergenic
1158423121 18:57313477-57313499 GGGGAGAAGGAGGAGAAGGAAGG + Intergenic
1158519791 18:58162334-58162356 GGGGGGAAGCTGGTGAAGGATGG - Intronic
1159379873 18:67643391-67643413 GGGGAGAAGAGGGAAAAGGAGGG - Intergenic
1159673370 18:71251002-71251024 GGGGAGAAGGTGGGGGAGGAAGG + Intergenic
1159843623 18:73430969-73430991 GTGGGCAAGGAGGAGAAGGAAGG - Intergenic
1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG + Intergenic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161370542 19:3908659-3908681 GAGGAGAAGGAGGAGAAGAAAGG - Intronic
1161403993 19:4081770-4081792 GAGGAGAAGGGGGAGTAGGAGGG - Intergenic
1161415663 19:4145236-4145258 GGGGAGGAGTGGGAGGAGGAGGG + Intergenic
1161641461 19:5426145-5426167 GTGGGGAAGTGAGACAAGGAAGG - Intergenic
1161821714 19:6534059-6534081 GAGGAGAAGGGAGAGAAGGAAGG - Intronic
1162021940 19:7872103-7872125 GTGGAGCAGAGGGAGAAGGAGGG + Exonic
1162090136 19:8274189-8274211 GTGGAGGAGTTGGTGGAGAAGGG - Intronic
1162092370 19:8289052-8289074 GTGGAGGAGTTGGTGGAGAAGGG - Intronic
1162254912 19:9482440-9482462 GGGGGGAAGGGGGAGAAGGAAGG + Intronic
1162549836 19:11352158-11352180 GGGGAGGAGTGGGAGAGGGAGGG + Intronic
1163018542 19:14471054-14471076 GTGGAGATGTGGGATTAGGAGGG - Intronic
1163101761 19:15101570-15101592 GTGGATATGTGGGAGAGGGAAGG + Intergenic
1163282212 19:16324948-16324970 CTGGCGAAAGTGGAGAAGGACGG - Exonic
1164250277 19:23469632-23469654 GTAGAGGAGATGGAGAAGGAGGG - Intergenic
1164441897 19:28285128-28285150 GAGGGGAAGAAGGAGAAGGAGGG + Intergenic
1164458291 19:28426988-28427010 GGGGAGGAGTTGGGGAAGGAAGG + Intergenic
1164612455 19:29641840-29641862 GAGGAGGAGAAGGAGAAGGAGGG + Intergenic
1164760922 19:30727745-30727767 GTGGGGTGGTTGGAGAAGTAAGG + Intergenic
1164868750 19:31626032-31626054 GAAGAGAAGGTGGAGAAGGAGGG - Intergenic
1165006292 19:32810219-32810241 GTGGAAAAGGTGGAGAAGTTTGG + Intronic
1165064475 19:33221015-33221037 GGGAAGAAGTGGGAGGAGGAAGG - Intronic
1165259440 19:34599275-34599297 GTGGAGGAGTTGGGGCAGGCAGG + Intronic
1165411696 19:35666241-35666263 GTGGAGGAGTTGGAGGTGGAGGG - Intergenic
1165905796 19:39193949-39193971 GAGGAGGAGAAGGAGAAGGAGGG - Intergenic
1165968452 19:39604698-39604720 ATGGAGGGGTTGGAGAAGAAGGG + Intronic
1166076700 19:40417776-40417798 GTGGAGAATCTGGGGAGGGACGG - Intergenic
1166312374 19:41970009-41970031 GAGGAGGAGGTGGAGAAGGATGG + Intronic
1166364945 19:42273623-42273645 GTGGAGACGGGTGAGAAGGAGGG - Intronic
1166914255 19:46183904-46183926 CTGGAGAAATTAGAGAAGCATGG - Intergenic
1167301396 19:48680051-48680073 AAGTAGAAGGTGGAGAAGGAAGG - Intergenic
1167579084 19:50331530-50331552 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167579096 19:50331570-50331592 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167579108 19:50331610-50331632 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167588308 19:50387646-50387668 GTGCTGAAGCTGGAGGAGGAAGG - Intronic
1167618050 19:50547030-50547052 GTGTATAAGTGGGGGAAGGATGG + Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1167792871 19:51691835-51691857 GTCCAGAAGCTGGAGAAGGCTGG + Intergenic
1168510160 19:56967369-56967391 GAGGAGAAGGAGGAGAAAGAGGG - Intergenic
1168644176 19:58049449-58049471 GTGGAGAAGTTGTAGGCGGGGGG + Intronic
1202683089 1_KI270712v1_random:28721-28743 GTGGAGATGGGGTAGAAGGACGG - Intergenic
924989703 2:302123-302145 GTGAAGAAGCTGCATAAGGAAGG + Intergenic
925044649 2:763649-763671 GGGGAGAAGGTGAAGATGGAGGG + Intergenic
925599765 2:5596348-5596370 GTGAAGAAGTGGGAGGAGGCTGG - Intergenic
925837623 2:7961159-7961181 AGGGAGAAGTTGGAGAAGTTAGG - Intergenic
926039283 2:9659900-9659922 ATGGGGAAGTTGGAGAATGTAGG - Intergenic
926056008 2:9774430-9774452 AAGGAGCAGTTGGAGCAGGAAGG + Intergenic
926582754 2:14649212-14649234 GTGGAGAGGATGGTGGAGGAAGG + Intronic
926975588 2:18513919-18513941 GTGGAGGAGTAGGAAAAGGTGGG - Intergenic
927114056 2:19884800-19884822 GTGGAGAAGTGGGACAAGCTGGG - Intergenic
927177961 2:20423519-20423541 GAGGAGTAGGTGGAGCAGGATGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927730724 2:25469253-25469275 GTGAAGATGTTGGATAAAGAGGG + Intronic
927990700 2:27444985-27445007 GAGGAGGACTTGGAGAATGAAGG - Intronic
928108440 2:28488172-28488194 GAGGAGAAGGAGGAGAAGGAGGG + Intronic
928172466 2:29012315-29012337 GTGGGGCAGTTGGCGAAGGGGGG + Intronic
928217808 2:29376914-29376936 GTGGAGAAGAAGGAGAGAGAGGG + Intronic
928781949 2:34833876-34833898 GTGGAGAAGGGGAAGAAGAAGGG + Intergenic
929219796 2:39451402-39451424 GTGGAGAACTGAGAGAAGAAGGG + Intergenic
929273916 2:40005061-40005083 GTGGAGAAGTTGTCTGAGGATGG + Intergenic
929365285 2:41147130-41147152 GTGGAAAAGATGAAGAAGGCAGG + Intergenic
929552542 2:42903666-42903688 GTGGAAAGCTGGGAGAAGGAAGG + Intergenic
929981648 2:46686989-46687011 CTGGTGAAGTTAAAGAAGGAAGG - Intergenic
930114619 2:47707923-47707945 GAAGAGAAGTGGGAGAGGGAAGG + Intronic
930468473 2:51783167-51783189 CTGGAGCAGCTGGAGAGGGAGGG - Intergenic
932134436 2:69215817-69215839 GTGAAGAATTTGAAGAAGAATGG - Intronic
932879569 2:75488569-75488591 GTAGAAAAGTGGGAGAAAGAAGG + Intronic
933427877 2:82136055-82136077 AGGGAGAAGTAGGAGAAGGGAGG - Intergenic
933585352 2:84174093-84174115 GTGGAGAGGGTGAAGAAGAAGGG + Intergenic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
934248708 2:90326455-90326477 GTGGAGATGGGGTAGAAGGACGG + Intergenic
934260872 2:91477024-91477046 GTGGAGATGGGGTAGAAGGACGG - Intergenic
934909940 2:98242599-98242621 GTGCAGAACCCGGAGAAGGACGG - Intronic
936071127 2:109371992-109372014 TTGGGGGAGTTGGAGAAGCATGG - Intronic
937160854 2:119759855-119759877 GAAGAGGAGGTGGAGAAGGAGGG + Exonic
937332181 2:121038506-121038528 ATGAAGAAGCTGGACAAGGAAGG + Intergenic
937490232 2:122359471-122359493 GAGGAGAAGACGGAGGAGGAGGG - Intergenic
937888095 2:126914216-126914238 GGGAGGATGTTGGAGAAGGAAGG - Intergenic
938173639 2:129104540-129104562 GTGGAGAGTTTTCAGAAGGAAGG + Intergenic
938639916 2:133267078-133267100 TTGGAGAAGCTGGAGAGTGAGGG + Intronic
940901682 2:159131547-159131569 GTGGAGCAGGTGGAGCAGAAAGG - Intronic
941309472 2:163911523-163911545 GAGGAGGAGGAGGAGAAGGAAGG - Intergenic
941591148 2:167422123-167422145 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
942232529 2:173873621-173873643 GTGGATAGGTTGGAGCAGGAAGG + Intergenic
942647879 2:178134220-178134242 CTGCAGAAGTGGCAGAAGGAAGG + Intronic
942695969 2:178645959-178645981 GTGGAGCAGGTGGAGGAGGTGGG + Exonic
943176700 2:184484830-184484852 GTTTAGAAGTTTGAGAAGTAAGG - Intergenic
944476122 2:200108497-200108519 GTGGAGAAGGAGGACAAGAAGGG - Intergenic
945240359 2:207671072-207671094 GGGGAGCGGTTGAAGAAGGATGG + Intergenic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945385678 2:209197490-209197512 TTGGAAAAGTTTGAAAAGGATGG - Intergenic
945950860 2:216037423-216037445 GTGGAGAAGATGGAAAAGGCAGG - Intronic
946095827 2:217273450-217273472 CTGGGGCAGTTGGAGGAGGATGG - Intergenic
946179867 2:217942785-217942807 GGGGAGGAGATGGAGGAGGAGGG - Intronic
946190385 2:218004738-218004760 CTGGAGGACTTGGAGAAGTATGG - Intergenic
946312196 2:218888502-218888524 GTGTTGAACATGGAGAAGGAAGG - Intronic
946705399 2:222453535-222453557 GAGGAGAAGGAGGAAAAGGAGGG - Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
947534032 2:230929672-230929694 GTGCAGAAGTTGGACAAAGGTGG + Intronic
948091770 2:235301691-235301713 GGAGAGAGGTGGGAGAAGGAGGG - Intergenic
948307434 2:236959843-236959865 GCGGAGAAGGAGGAGAAGGTGGG + Intergenic
948332877 2:237183966-237183988 GTGGGGAAGTTGGAGAATTTGGG - Intergenic
948488314 2:238295350-238295372 GAGAAGAAGTAGAAGAAGGAGGG - Intergenic
948698792 2:239747839-239747861 GTGAAGAGGTTGGAGAGAGAAGG - Intergenic
948765729 2:240217736-240217758 GTGGAGATGGTGGAGATGGGTGG - Intergenic
948939253 2:241187931-241187953 GAGGAGAAGGAGGAGAGGGAAGG + Intergenic
1168754999 20:310219-310241 GTGGAGAAGTCAGGGAAGGATGG + Intergenic
1169716321 20:8622687-8622709 GTGGGGAAGTAAGACAAGGAGGG - Intronic
1169840163 20:9926818-9926840 GTGGAGAAGTAAGACAAGGAAGG - Intergenic
1169965497 20:11213146-11213168 GGGAGGAAGTTGGAGAAGAAGGG - Intergenic
1170938308 20:20828122-20828144 GTGGAGGAGTGAGGGAAGGAAGG + Intergenic
1170942994 20:20864533-20864555 GTGGAGATGTTGGACTTGGATGG + Intergenic
1171070485 20:22063301-22063323 GAGGAGGAGGAGGAGAAGGAAGG - Intergenic
1171178218 20:23070965-23070987 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1172063718 20:32205284-32205306 GGGGAGATGTTGGGAAAGGAAGG - Intronic
1172525364 20:35597798-35597820 GTGTAGAGGTTGGGGAAGGGTGG - Intergenic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1172832363 20:37846701-37846723 GAGAAGAGGTTGGAGAAGCAGGG - Intronic
1173178360 20:40782701-40782723 GAGAGGAAGTGGGAGAAGGAGGG + Intergenic
1173469020 20:43308251-43308273 GGGGAGAAATAGGGGAAGGAGGG + Intergenic
1173570813 20:44074955-44074977 GGGGAGAAGGTGGGGAAGAAAGG + Intergenic
1174122061 20:48273257-48273279 GGGGAAAAGTGGGAGAGGGAAGG + Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1174982283 20:55409283-55409305 GAGGAGAAGGTGGAGCAAGATGG - Intergenic
1174998945 20:55604677-55604699 GTGGGGAAGGTGGAGCAAGACGG - Intergenic
1175347304 20:58289345-58289367 GTGGGGGAGTGGGAGAAGGGAGG - Intergenic
1175383813 20:58581450-58581472 GTGGAGAGGTTGGAGAGGTGGGG + Intergenic
1175682827 20:61003593-61003615 ATTGAGAAGTGGCAGAAGGAGGG - Intergenic
1175807454 20:61837810-61837832 GAGGAGGAGGAGGAGAAGGAAGG - Intronic
1175933637 20:62505139-62505161 GTGGTGAAGTTGGGGAAGCTGGG + Intergenic
1176062013 20:63176589-63176611 CTGGAGAGGGTGGAAAAGGAAGG + Intergenic
1176121259 20:63455579-63455601 GAGGAGAAGTTGGGGCAGGGAGG + Intronic
1177060264 21:16364485-16364507 GAGGAGAAAGAGGAGAAGGAAGG - Intergenic
1177215165 21:18118916-18118938 TTGGAGAACTAGGAGATGGAAGG - Intronic
1177260972 21:18729368-18729390 GTGGGGAAGTGGAAGAAGCAAGG + Intergenic
1177318054 21:19486658-19486680 GTGGAGAACTTGGAGAGAAAAGG - Intergenic
1177584913 21:23078825-23078847 GTGGAGGAGTTAGAGAAATAAGG - Intergenic
1178345936 21:31828044-31828066 CTGGACAAGATGGAGAAAGAGGG + Intergenic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178580276 21:33832202-33832224 GTGGAGAGGTTGGAGCTGGTTGG - Intronic
1178869965 21:36365156-36365178 GAGGAGTGGATGGAGAAGGAAGG + Intronic
1178882480 21:36460453-36460475 GTGGGGACGTTGGAGGAAGACGG - Intergenic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1179603374 21:42496149-42496171 TCGGAGGAGTTGGAGGAGGAGGG - Exonic
1180105952 21:45618176-45618198 TGGGAGAAGTTACAGAAGGAAGG - Intergenic
1180228849 21:46414376-46414398 GAGGAGAAGGAGGAGAAGGGTGG - Intronic
1180285913 22:10744182-10744204 GAGGAGAAGTTAGATAAGGCTGG + Intergenic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180391236 22:12284215-12284237 TTGAAGATGTTGGAGAAGCAAGG - Intergenic
1181023749 22:20116500-20116522 CTGGAGGAGGTGGAGAAAGAGGG - Exonic
1181521111 22:23449288-23449310 GTGGCGGGGATGGAGAAGGAGGG - Intergenic
1181896508 22:26112917-26112939 GGGGAGAGGTTGGAAAAGAAGGG - Intergenic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182550563 22:31098809-31098831 ATTGAGAAGCTGGAGAAGGAGGG + Exonic
1183252953 22:36743346-36743368 GTGGAGAAGTGAGACAGGGATGG - Intergenic
1183477146 22:38042035-38042057 GGGGAGGAGTTGGGGAAGGATGG + Intergenic
1183565565 22:38611998-38612020 GAGGAGAAGTGGGGGAAGAAAGG - Intronic
1184281188 22:43438398-43438420 GTTGGGAAGTGGGAGAAGCAGGG + Intronic
1184291894 22:43501813-43501835 GAGGAGGAGGGGGAGAAGGAGGG - Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1184797009 22:46738383-46738405 GGGGAGAAGAGGGAGGAGGAAGG + Intergenic
1185004877 22:48270013-48270035 GAGGAGGAGTGGGAGAGGGAGGG + Intergenic
1185311799 22:50160199-50160221 GGGGAGAAGGGGGAGGAGGAAGG - Intronic
949853854 3:8442126-8442148 TTGGGGAAGGTGGAGAAGAAGGG + Intergenic
949952155 3:9238224-9238246 ATGGAGGAGATGGAGAAGGAAGG + Intronic
950326441 3:12114776-12114798 GTGGAGAAGGTGGGGAAGAGGGG - Intronic
950897553 3:16467378-16467400 CTGGAGCAGTCTGAGAAGGAGGG - Intronic
950901298 3:16500185-16500207 GTGGAGCTGTGGGAGCAGGATGG - Intronic
951474945 3:23094904-23094926 GTGGAATACATGGAGAAGGAAGG + Intergenic
951797611 3:26558241-26558263 GTGGAGAGATTGGAAAAAGAAGG + Intergenic
951865340 3:27300947-27300969 GTGGGGAAGTGGGAGAGGGCAGG - Intronic
952106727 3:30078780-30078802 GGGCAGAAATAGGAGAAGGATGG - Intergenic
952840895 3:37644432-37644454 GTGGGGAAGTTGGAGCTGGGTGG + Intronic
953227688 3:41035428-41035450 GGGGAGAAGGAGGGGAAGGAGGG - Intergenic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953448595 3:42988203-42988225 GAGGAGAAGTTGGGCTAGGAAGG - Intronic
953484067 3:43277957-43277979 GAGGAGGAGGAGGAGAAGGAAGG + Intergenic
953535084 3:43771097-43771119 GGGGAGAAGATGGAGAAGACTGG + Intergenic
953812532 3:46126154-46126176 TTGGAAGAGTTTGAGAAGGATGG - Intergenic
954021006 3:47741568-47741590 GTTGAGTAGTTGGAGGAGTAAGG - Intronic
954133800 3:48572877-48572899 GTGGAAAAGATGGAGACAGAGGG - Exonic
954157547 3:48694951-48694973 GAGGAGAAGGAGGAGAGGGAGGG + Intronic
954264493 3:49461853-49461875 GAGGAGGAGGAGGAGAAGGAGGG - Intergenic
954367399 3:50154001-50154023 GAGGAGAAGGAGGAAAAGGAGGG + Intergenic
954710868 3:52504514-52504536 GAGGAGAAGGAGGAGACGGATGG - Exonic
954847380 3:53571601-53571623 GTGGGGGAGCTGGAAAAGGATGG + Intronic
955307421 3:57848310-57848332 GAGGAGAAGGGGGAGAAGAAGGG - Intronic
955631400 3:60979367-60979389 GTGGGAAGGTTGGAGAAGGCTGG - Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956643357 3:71435146-71435168 GAGGAGAGGAAGGAGAAGGAGGG + Intronic
956752191 3:72352291-72352313 GTGGAGAAGATGGAGAGGGGTGG - Intergenic
957001026 3:74884946-74884968 GTGGAGAAATTGGGGAAGAAGGG - Intergenic
957181056 3:76877910-76877932 GAGGAGAAGGGAGAGAAGGAAGG + Intronic
957390329 3:79558194-79558216 GTAGAGAAGTTGGAAGGGGAAGG - Intronic
958492821 3:94799211-94799233 TTTGAGAAGTTGAAGCAGGAGGG - Intergenic
958584092 3:96062829-96062851 GAGGAGGAGAAGGAGAAGGAGGG - Intergenic
958814467 3:98901196-98901218 GAGGAGGAGTTGGAGCAGGGAGG + Exonic
959364531 3:105440435-105440457 GTGATGAAGTTGAAGAAGGGAGG + Intronic
959771178 3:110098499-110098521 GTACAAAAATTGGAGAAGGATGG + Intergenic
959940470 3:112075770-112075792 GTGGAGAATGTGGAGAAAAATGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
959993486 3:112654907-112654929 GTGCAGAAGTGGGAGAATGAGGG - Intergenic
960174839 3:114504755-114504777 GTGGAAGAGTTTGAGAAGCATGG + Intronic
960329008 3:116334332-116334354 TTGGAAATGTTTGAGAAGGACGG - Intronic
960425863 3:117507222-117507244 GTGAAGAAGTTGAAGAATTAAGG + Intergenic
960476424 3:118135071-118135093 GTGAGGAAGCTGCAGAAGGAAGG + Intergenic
960513836 3:118581079-118581101 GAGGAGAAGAGAGAGAAGGATGG - Intergenic
960577039 3:119240433-119240455 GTTGAAACGCTGGAGAAGGAGGG + Exonic
960970854 3:123139234-123139256 GTGGGACAGTTGGAGGAGGAGGG - Intronic
961481511 3:127183740-127183762 GTGGAGGAGGGGGAGAGGGAGGG - Intergenic
961522473 3:127475069-127475091 GGGGAGAGGGTGGGGAAGGAAGG + Intergenic
961528265 3:127522703-127522725 GTGGAGAAGTTGTCGATGTAAGG - Intergenic
961532438 3:127547717-127547739 GAGGAGGGGTTGGAGTAGGAGGG - Intergenic
961999211 3:131277611-131277633 TTAGAGAACTTGGAGAAGGATGG - Intronic
962580585 3:136794402-136794424 TTGGGGAAGTGGGAGATGGAAGG - Intergenic
962873508 3:139518464-139518486 GTGCAGAAGGGTGAGAAGGAGGG - Exonic
962915530 3:139899654-139899676 GTGTTGAAGGTGGAGAAAGAGGG + Intergenic
962938106 3:140100293-140100315 GTGGAGGGGAGGGAGAAGGAGGG - Intronic
963005488 3:140723105-140723127 GTGAAGAAGTTGGGAGAGGAAGG - Intergenic
963223053 3:142832209-142832231 GTCGAGGAGGTGGAGAAGGGTGG - Intronic
963460004 3:145600036-145600058 GAGGAGGAGAAGGAGAAGGAGGG + Intergenic
963534704 3:146513157-146513179 GTGAGGAAGGGGGAGAAGGAGGG - Intergenic
964126801 3:153241819-153241841 GTGGAGAAGCTGCAGAAAAAAGG + Intergenic
964261912 3:154849023-154849045 GTGGAAAAGGTGGAGAAGGATGG + Intergenic
964870433 3:161307969-161307991 GTGAGGAAGCTGCAGAAGGAAGG + Intergenic
965303796 3:167038252-167038274 GTGGAGGAGATGGAGAAAGGGGG + Intergenic
965339944 3:167477651-167477673 GTGGAGAAGGCGGTGATGGAAGG - Intronic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
965451576 3:168845384-168845406 GAGGAGGAGTAGGAGGAGGATGG - Intergenic
965523971 3:169697381-169697403 GTGGGGAAGTGAGACAAGGAAGG - Intergenic
965551267 3:169967071-169967093 GTGGAGCAGCAGGGGAAGGAAGG + Intronic
965977037 3:174638559-174638581 TAGGAGATGTTGAAGAAGGAGGG + Intronic
965991166 3:174819934-174819956 ATGGAGAAATTGGATTAGGAAGG - Intronic
966263115 3:178003602-178003624 GGGGAGGAGTTGGGGAGGGAGGG - Intergenic
966265142 3:178031359-178031381 TTGGAGAGGTAGGATAAGGAAGG - Intergenic
966438907 3:179921790-179921812 GTGTAGGAGTTGGAGTAGTAGGG - Intronic
966877507 3:184331550-184331572 CTGGAGAAGCTGCTGAAGGAGGG + Exonic
966908496 3:184544545-184544567 GGGGAGAAGGAGGAGGAGGAGGG - Intronic
967249249 3:187520068-187520090 GAGGAGGAGAAGGAGAAGGAAGG + Intergenic
967483372 3:190000758-190000780 TTTTAGAAGTTAGAGAAGGACGG + Intronic
967497317 3:190156157-190156179 ATGCAGAAGTGGGAGAAGGCTGG + Intergenic
968091012 3:195898193-195898215 GTGGAGAAGGTGGAGGACGGAGG - Intronic
968095667 3:195928556-195928578 GAGCAGAAGAAGGAGAAGGAAGG - Intergenic
968165775 3:196464070-196464092 GTGGAGAAGAGCCAGAAGGAAGG + Intergenic
968782846 4:2596288-2596310 GTGGAGAAGGAGGAGAGGCATGG + Intronic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
969261259 4:6035626-6035648 GTGCAGATGCTGGAGAAGGAGGG + Intronic
969349670 4:6591166-6591188 CTGGAGGAGTGGGAGAGGGAAGG + Intronic
970044332 4:11833531-11833553 GTTGAGAGGTGGGGGAAGGAGGG - Intergenic
970091374 4:12411922-12411944 GTGGAGAAGTGTGAAAAGAAAGG - Intergenic
970221744 4:13818875-13818897 GTGGTGAAGGTGGAGCAGGTGGG - Intergenic
971044590 4:22791223-22791245 GTGGAGAAGTCCAAGAAGAAAGG + Intergenic
971626115 4:28922103-28922125 GTGGAGAAGAAGGGGAAAGAGGG + Intergenic
971663812 4:29456291-29456313 GTTGAGAAGTTGGACAATGCAGG - Intergenic
971926078 4:33011109-33011131 GTTGAAAACTTGGAGAAAGAAGG - Intergenic
972231127 4:37073811-37073833 GTGGAGAAAGTGGAGAAGTGAGG - Intergenic
972333726 4:38086886-38086908 ATGTAGAAGTTAGAGAAGCACGG + Intronic
972375585 4:38466599-38466621 AGGGTGGAGTTGGAGAAGGAGGG - Intergenic
972444992 4:39135472-39135494 CTGGAGACATTGCAGAAGGAAGG - Intergenic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
972727967 4:41762591-41762613 GTGGACAAGATGGAGAAATATGG + Intergenic
973530897 4:51835961-51835983 GTGGAGCAGTGGGAGGAGGAAGG - Intergenic
974795036 4:66738048-66738070 GTGAAGAAGTGGGACATGGAAGG + Intergenic
975570704 4:75815071-75815093 GTGGTGAAGATGGAGAATGGTGG - Intergenic
976184118 4:82429027-82429049 GCGGAGGGGTTGGAGGAGGAGGG - Intronic
976838880 4:89407861-89407883 GGCTGGAAGTTGGAGAAGGAGGG + Intergenic
977677261 4:99761877-99761899 GTGGGCAAATTGAAGAAGGAAGG - Intergenic
977865773 4:102025762-102025784 GAGAAAAAGTGGGAGAAGGAAGG - Intronic
978867569 4:113532609-113532631 CTAGAGAAGTTGGAGAAGGATGG - Intronic
980425640 4:132624470-132624492 ATAGAGAAGAAGGAGAAGGAAGG - Intergenic
980463961 4:133150766-133150788 GGGGAGGAGTAGGAGAAGGAGGG + Exonic
981514027 4:145587770-145587792 GTGGAGGAGGAGGAGAAGGAAGG + Intergenic
982226253 4:153170161-153170183 GTGGAGGAGAAGGAGAATGAAGG + Intronic
983064186 4:163190469-163190491 GTGGTGAATTTTGAGAGGGAAGG + Intergenic
983881502 4:172938295-172938317 GAGGAGGAGGTGGAGGAGGAGGG + Intronic
984508723 4:180653646-180653668 GTGGAAGATTTGGAGAAAGAAGG + Intergenic
984864232 4:184267667-184267689 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
985038310 4:185863032-185863054 GTGGAGAGGTGGGACACGGAAGG + Intronic
985046511 4:185946278-185946300 ATGTAGAAGTTGGAGGAGGCAGG + Intronic
985311072 4:188600007-188600029 GTGAAGAAGCTGAAGAAGAAAGG - Intergenic
985944765 5:3170550-3170572 ATGGAGATTTAGGAGAAGGACGG - Intergenic
985996756 5:3601075-3601097 GGGGAGGAGTTGGGGAGGGAGGG + Exonic
986007318 5:3678721-3678743 GAGGAGAAGGTGGTGATGGAGGG - Intergenic
986196106 5:5537443-5537465 GGGGAGAAGAGGGAGATGGATGG + Intergenic
986775074 5:11006778-11006800 AGGCAGAAGATGGAGAAGGATGG + Intronic
987910136 5:24132395-24132417 GAGGAGGAGAGGGAGAAGGAGGG + Intronic
988772881 5:34449749-34449771 GTGGGGAAGTGAGAGAGGGAAGG + Intergenic
989519824 5:42388546-42388568 GTGGAGGAGCTGGAGAAGAATGG - Intergenic
989740537 5:44766123-44766145 GTGTAGAAATGGGAGAAAGAAGG - Intergenic
990005239 5:50937929-50937951 GTGCAGAGGTTGGAGAAGCTTGG + Intergenic
990916433 5:60911207-60911229 GGGGAGAATGTGGAGAAGTAGGG - Intronic
990938199 5:61173125-61173147 TAGGGGAAGTTGGAGAAGGTGGG - Intergenic
991264391 5:64700235-64700257 GTGGAAAAGTTTGAGAAGCAGGG - Intronic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
991609049 5:68431867-68431889 TTGGAGAACTCTGAGAAGGAGGG + Intergenic
991939847 5:71839914-71839936 GAGGAGAAGTTCAAGGAGGATGG + Intergenic
992023930 5:72652433-72652455 GTGGAGAAGTGGGACAAGGATGG + Intergenic
992201011 5:74383977-74383999 GTGGATGAGGAGGAGAAGGAGGG + Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
994057517 5:95435005-95435027 GTGAAAAAGATGGAGAAAGAAGG + Intronic
994714665 5:103307098-103307120 GTGGAGAAGGAGAAGAAGAAGGG + Intergenic
995101974 5:108322560-108322582 GTGGAGAAGATGGTGATTGATGG + Intronic
995607060 5:113868360-113868382 TTTTAGAAGTTAGAGAAGGAGGG - Intergenic
995742211 5:115366790-115366812 GTTGAGAAGGTGGACAGGGAGGG + Intergenic
995883734 5:116870213-116870235 GTGGAAAAGATGGAAAAAGATGG + Intergenic
996139229 5:119885382-119885404 GTTGCAAAGTTGGAAAAGGAAGG - Intergenic
996315754 5:122158876-122158898 GGGAAGAAGCTGGAGAATGAAGG + Intronic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
997191034 5:131935863-131935885 GTTGAGGATATGGAGAAGGATGG - Intronic
997584177 5:135034782-135034804 GAGAAGAGGCTGGAGAAGGAGGG - Intronic
997596222 5:135109025-135109047 GAGGATAGGCTGGAGAAGGAAGG + Intronic
997877213 5:137560117-137560139 CTGGAGCAGAGGGAGAAGGAAGG - Intronic
997889186 5:137659990-137660012 GAGGAGGAGGAGGAGAAGGAAGG - Intronic
997920547 5:137975234-137975256 GTGAAGAAGTTGCAGAAGAGGGG - Intronic
998102914 5:139449166-139449188 GTGGAGCAGCTGGGGGAGGAAGG + Exonic
998499038 5:142616004-142616026 CTGGAGAAGGTGGAGATGCATGG - Intronic
998885697 5:146691700-146691722 GTGGAGAAAGTGGAGAGGGCAGG - Intronic
998949638 5:147379962-147379984 GTGGAGAAGTTTAAGAAGTGTGG - Intronic
999256252 5:150211405-150211427 GAGGAGGAGTGGGAGAGGGAAGG - Intronic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
999664967 5:153903555-153903577 GTGGAGAATATGTAGAAGGAGGG - Intergenic
1000112794 5:158125197-158125219 GAGGAGAAAGTGGGGAAGGAAGG + Intergenic
1001172706 5:169435914-169435936 GTTGAGTAGTTGGAAAAGAAAGG - Intergenic
1001737995 5:174022793-174022815 GTGGAGTTGTTGGAGACAGAGGG + Intergenic
1001794263 5:174489030-174489052 GGGTGGAAGTTGGACAAGGACGG - Intergenic
1002483914 5:179522286-179522308 GTTGAGAAGGTGGAGTGGGAAGG + Intergenic
1002929848 6:1625469-1625491 GTGGAGCAGTTGGGGAAAGCGGG - Intronic
1003528418 6:6917497-6917519 GGGGTGAAGTGGGAGAAAGATGG - Intergenic
1003632008 6:7795649-7795671 GGATAGAACTTGGAGAAGGAGGG + Intronic
1003660014 6:8051371-8051393 GTGAGGAAGCTGCAGAAGGAAGG + Intronic
1003856939 6:10286042-10286064 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1003875684 6:10434254-10434276 GAGGAGCAGTCGAAGAAGGAGGG + Intergenic
1004266431 6:14152007-14152029 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1005783960 6:29222972-29222994 GTGTAGAAGAAGGAGAATGAAGG - Intergenic
1005826827 6:29637268-29637290 GTACAGAAGTGAGAGAAGGATGG - Intergenic
1005856550 6:29867231-29867253 GAGGAGAAGCTGGAGAGGGGAGG + Intergenic
1005898532 6:30198032-30198054 GTGGAGAGGGTTTAGAAGGAGGG - Intronic
1005976198 6:30801627-30801649 GTGGAGAAGTGGGCAGAGGAAGG + Intergenic
1006101723 6:31689802-31689824 GCAGAGAAGGTGTAGAAGGAAGG + Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006382072 6:33704782-33704804 CTAGAGAAGTTGGAGCAGGAAGG - Intronic
1006834352 6:36987703-36987725 GTGAGGAAGTTTCAGAAGGATGG - Intergenic
1007313313 6:40963885-40963907 GTGGAGAAGTGAGACAGGGAAGG + Intergenic
1007380764 6:41488765-41488787 GGGGAGCAGATGGGGAAGGAGGG + Intergenic
1007707904 6:43802459-43802481 TTGGAGAAGCTGGAGAGGAATGG - Intergenic
1007821148 6:44561471-44561493 GTCGAGAAGCTGGAGAGGAAGGG + Intergenic
1008090202 6:47286027-47286049 GAGGTGGAGCTGGAGAAGGACGG + Exonic
1008811137 6:55500774-55500796 CTGGAGAAGGTGGCTAAGGATGG + Intronic
1008878201 6:56352322-56352344 GTGGACAAGTGGGAGAAGAATGG + Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1009548859 6:65059906-65059928 CTGGTGAAGTTGGAGAAACATGG + Intronic
1009860651 6:69326774-69326796 GTGGAGGAAGAGGAGAAGGAGGG + Intronic
1009938901 6:70267059-70267081 GTGAGGAAGTTGGAGAAATAGGG - Intronic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010567181 6:77430578-77430600 AAGGAGAAGTTGTTGAAGGATGG - Intergenic
1010917704 6:81641330-81641352 TTGGAGAAGATGGACATGGAAGG + Intronic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011752452 6:90466773-90466795 GTGGATAAGTTAGTGAAGGCTGG + Intergenic
1013071096 6:106729993-106730015 TTTGAGCAGGTGGAGAAGGAGGG + Intergenic
1013305921 6:108847078-108847100 GAGGAGGAGGAGGAGAAGGAAGG - Intergenic
1013563656 6:111333117-111333139 GTGGAGAACTTGGGAAAGTAAGG - Exonic
1013585381 6:111573842-111573864 GGGCAGAAGATGGAGAAGAAAGG + Intronic
1013597452 6:111672906-111672928 GTGGGGGCCTTGGAGAAGGAAGG - Intronic
1014011836 6:116484987-116485009 GTGAGGAAGTGGGAGAAGGCAGG - Intergenic
1014074452 6:117220266-117220288 GAGGAGGAGTTGGAGATGGAAGG + Intergenic
1014730095 6:125022426-125022448 CTGGGGAAGTTGGACTAGGAAGG + Intronic
1014804621 6:125814703-125814725 GTGGAGAAGAGGGAGACGCAAGG + Intronic
1014862247 6:126484514-126484536 GGGGAGAAGATGGAGCAAGATGG + Intergenic
1015280028 6:131423142-131423164 GTGATGAAGGTGAAGAAGGAAGG - Intergenic
1015469473 6:133587454-133587476 TTGGATACGTTGGAGAAGGGAGG - Intergenic
1015906634 6:138123648-138123670 GCAGAGAAGATGGAGAGGGATGG - Intergenic
1015932618 6:138376561-138376583 GTAGACAAGGTGGAGAAGGATGG + Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016580353 6:145622756-145622778 GTGTAGAAGTTGGAGATGAAAGG - Intronic
1016635294 6:146282252-146282274 GTGGAGAAGGTGGACAATGAAGG - Intronic
1016832471 6:148447623-148447645 GAGGAGGAGGAGGAGAAGGAAGG - Intronic
1017055060 6:150429389-150429411 GGGTAGAAGCTGGAGAGGGAGGG + Intergenic
1017994888 6:159523365-159523387 GTGGAGGAGTAGGAGAAGAAGGG - Intergenic
1018418471 6:163621566-163621588 ATGGAGGAGTTGGAGAAGAGTGG - Intergenic
1018656660 6:166043243-166043265 GTGGAGAGGCTGGGGAGGGAGGG + Intergenic
1018681311 6:166268281-166268303 GTTGAGGAGAAGGAGAAGGAGGG + Intergenic
1019320738 7:414283-414305 GAGGGGAAGGAGGAGAAGGAGGG - Intergenic
1019494936 7:1333395-1333417 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1019704243 7:2489991-2490013 GTGGAGAGGGTGGAGACCGAGGG - Intergenic
1019911056 7:4100754-4100776 GTGGGGAAGGTGGTGTAGGAGGG + Intronic
1019932746 7:4234559-4234581 GTGGGGGAGCTGGAGAGGGAGGG + Intronic
1019993892 7:4711050-4711072 TTAGAGAAGATGGAGATGGATGG + Intronic
1020290211 7:6717247-6717269 GTGCAGAAGTTGGAAGATGAGGG + Intergenic
1021056007 7:16046977-16046999 GTGCAGGGATTGGAGAAGGAGGG + Intergenic
1021775929 7:24055580-24055602 GTGGAGAAGTACGACCAGGAAGG + Intergenic
1021943798 7:25705290-25705312 GTGGGGATGGGGGAGAAGGAGGG + Intergenic
1022010883 7:26307324-26307346 ATGGGGAAGTTGGAAAAGGGGGG - Intronic
1022113276 7:27244079-27244101 GTGGAGAAGTGGGACTAGGAAGG - Intronic
1022146588 7:27548395-27548417 AGGGAGAAGTTGGAGAATGGAGG + Intronic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1023073195 7:36458084-36458106 GTGTAGAAGTTGGACAAAAAGGG - Intergenic
1023184699 7:37521140-37521162 GTGGAGAATTTTGAGAAACAAGG + Intergenic
1023214454 7:37847256-37847278 GAGGAGGAGGAGGAGAAGGAGGG + Intronic
1023214476 7:37847382-37847404 GAGGAGGAGGAGGAGAAGGAGGG + Intronic
1023214528 7:37847688-37847710 GAGGAGGAGGAGGAGAAGGAGGG + Intronic
1023224605 7:37956105-37956127 GTGAAGAAGAAGGAGCAGGAAGG + Intronic
1023234175 7:38066603-38066625 GAGGACCAGTTGGAGAAGGCAGG - Intergenic
1023412171 7:39899040-39899062 GAGGAGAAGTAGGAGGAGGGTGG - Intergenic
1024107482 7:46107946-46107968 ATGGAGGAGTTGTAGAATGAAGG - Intergenic
1024160787 7:46673118-46673140 GTGGAGAATTTAGTTAAGGAAGG + Intergenic
1024678921 7:51662929-51662951 GTTGACTAGTTGGAGTAGGATGG + Intergenic
1025625748 7:63219714-63219736 GTGGAGAGGGTGGTGTAGGAGGG + Intergenic
1026086933 7:67270479-67270501 GGGGAGGGGATGGAGAAGGAAGG - Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026636678 7:72088763-72088785 GAAGAGAAGTAAGAGAAGGAAGG + Intronic
1026638331 7:72103742-72103764 TTGGAGAAGATGGAAATGGAGGG + Intronic
1027411134 7:77918945-77918967 TTGGAGAAGAAGGACAAGGAAGG + Intronic
1029361241 7:100089804-100089826 GTGGGGAAGATGGAGAGGGTTGG + Intronic
1029364327 7:100107389-100107411 GGGGAGGAACTGGAGAAGGATGG + Exonic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030679183 7:112416203-112416225 GTGAAGGAGCTGGAGATGGAAGG + Intergenic
1031500432 7:122507799-122507821 GTGGAGAAGATGGAGATGACTGG + Intronic
1031604003 7:123748168-123748190 GTGGATAGGTCGGGGAAGGAAGG - Intronic
1032064296 7:128753959-128753981 GTGGAGAACTTGGATAGGAATGG + Intronic
1032565804 7:132941664-132941686 GAGGAGCAGTTGGAGAAGCAGGG - Intronic
1032565975 7:132944288-132944310 GAGGAGCAGTTGGAGAATCAAGG - Intronic
1032669375 7:134069323-134069345 GAGGAGAAGGAGGAGAAGGAGGG - Intergenic
1032704877 7:134413160-134413182 GAGGAGAACTTGGGGAAGCAGGG + Intergenic
1032848523 7:135772476-135772498 GTGGAGAAGTTGCATCAGCAAGG + Intergenic
1032861795 7:135886886-135886908 GTGGGGAAGTTGCAGAACAAAGG + Intergenic
1033368921 7:140691683-140691705 GTGTTGAAGGTGGAGAAGGGAGG + Intronic
1033712110 7:143958400-143958422 GAGGAAATGTTGGAGAAGGAAGG + Intergenic
1034679205 7:152915807-152915829 GGGGAGGAGAAGGAGAAGGAGGG - Intergenic
1034908220 7:154970009-154970031 GCTGAGGAGTAGGAGAAGGACGG + Intronic
1034980409 7:155472223-155472245 GGGGACAGGTCGGAGAAGGATGG - Intergenic
1035183495 7:157108016-157108038 GTGCAGAAGGTGGAGAGTGAAGG + Intergenic
1035284730 7:157799016-157799038 ATCTAGAAGTTGGAGAAGAAAGG - Intronic
1035482942 7:159202009-159202031 GGGGTGCAGGTGGAGAAGGAGGG + Intergenic
1035847026 8:2876042-2876064 GAGAAGGAGTTGGAGGAGGAGGG + Intergenic
1036448735 8:8846315-8846337 GAGGAGAAGGAGGAGTAGGAGGG + Intronic
1036659425 8:10698413-10698435 GGGGAGAAGATGGAGGAGGCAGG + Intronic
1037380372 8:18278582-18278604 CTGGAGATCTTGAAGAAGGAGGG - Intergenic
1037746891 8:21652659-21652681 TTGGAGATATGGGAGAAGGATGG + Intergenic
1037883082 8:22582276-22582298 GCAGGGCAGTTGGAGAAGGAGGG - Intronic
1038245944 8:25856160-25856182 GTGAAGAGGATGGAGAAGAAAGG - Intronic
1038276844 8:26128264-26128286 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1039097508 8:33902355-33902377 ATGGAGAAGGTGGAAAATGAGGG - Intergenic
1039203495 8:35123253-35123275 GGGGAGTATCTGGAGAAGGAAGG + Intergenic
1039363195 8:36902416-36902438 GTGGAGAGGGTGGAGAAGGAGGG + Intronic
1039568414 8:38567003-38567025 GAGGAGCAGGTGGAGGAGGAAGG + Intergenic
1039680562 8:39730658-39730680 CTGGAGAGGTGGGGGAAGGAGGG + Intergenic
1040570487 8:48605051-48605073 GAGGAGAGGTTGGAGGAGGGTGG + Intergenic
1040628495 8:49179989-49180011 GTGGAGGAGGTAGAGAAGGGAGG + Intergenic
1040743326 8:50607263-50607285 CTGGAGAAGTTTGTGTAGGATGG + Intronic
1041523607 8:58781382-58781404 ATAGGGAAGTTGGTGAAGGATGG + Intergenic
1042035333 8:64526760-64526782 GTGGAGAAATTGGACAGGAAGGG + Intergenic
1042130488 8:65582761-65582783 GAGGAGGAGATGGAAAAGGAGGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043620512 8:82186300-82186322 GGGGAGGGGTTGGAGAAGCATGG + Intergenic
1044300445 8:90577332-90577354 GTGGAGAAGTTTGAGAAGCTGGG - Intergenic
1044461017 8:92443937-92443959 ATGGAGAAGTTTCAAAAGGACGG + Intergenic
1044986602 8:97761509-97761531 GTGTCAAAGGTGGAGAAGGAAGG - Intergenic
1045111454 8:98941696-98941718 GAGGAGGAGGTGGAGGAGGAGGG - Intronic
1045825531 8:106393019-106393041 GTGGAGAAGTTGGAGAAGGATGG - Intronic
1045967549 8:108042646-108042668 GTGGGGAGCTTGGAGAAGTAAGG + Intronic
1046066805 8:109207130-109207152 GTGGAGCAGTAGGGGATGGAGGG + Intergenic
1046131729 8:109974803-109974825 GTGGAGGGGTTGGGGAAGGGAGG + Exonic
1047210953 8:122839873-122839895 GTGGAGAAGGTGGACATTGATGG + Intronic
1047240929 8:123087062-123087084 GTGGAGAAGTCAGAGGAAGATGG + Intronic
1047370699 8:124253502-124253524 GAGGAGAAGATGGGGAAGGGAGG - Intergenic
1047520433 8:125591700-125591722 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1047591256 8:126329860-126329882 GTGGAGAAGTGAGACAAAGAAGG + Intergenic
1048086585 8:131187104-131187126 GTGGTGAGGTTGGGGGAGGAGGG + Intergenic
1048268221 8:133005942-133005964 AGGGAGAAGATGGAGTAGGAGGG - Intronic
1048799067 8:138179667-138179689 GTGGAGTAGTGTGAGGAGGATGG - Intronic
1048962390 8:139591293-139591315 CTGGGGCAGTTGGAGAAGCAGGG - Intergenic
1049404307 8:142444906-142444928 GTGCAGATGTTGAGGAAGGATGG - Intergenic
1049464157 8:142743580-142743602 GTGGATAAGTTGGGGATGAATGG + Intergenic
1049674039 8:143881873-143881895 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1049942424 9:560289-560311 ATGGATAAGTTGGAAAAGCATGG + Intronic
1050125442 9:2352580-2352602 GTGGGGAAGGTTGAGAAGAAGGG + Intergenic
1050479193 9:6072645-6072667 ATGGAGAAGTTGCAGAGAGATGG - Intergenic
1050536448 9:6634816-6634838 GGGGAGAAGCGGGAGAGGGAAGG - Intronic
1050801017 9:9614989-9615011 GGGGAGAAATTGCAGGAGGAAGG + Intronic
1051157480 9:14166644-14166666 GTGGAGAAATTGGAGGATGTAGG - Intronic
1052750321 9:32483511-32483533 TTGGGGAAGTAGCAGAAGGATGG - Intronic
1053043197 9:34891949-34891971 GGGGAAAAGGTGGGGAAGGAGGG + Intergenic
1053279042 9:36805613-36805635 TTGGTGAAGCTGTAGAAGGATGG + Intergenic
1053292354 9:36889629-36889651 GTCTAGAAGCAGGAGAAGGATGG - Intronic
1053585792 9:39457261-39457283 GCGGAGATGTGGAAGAAGGAAGG - Intergenic
1053800056 9:41758431-41758453 GGGCTGAAGTTGGAGGAGGAGGG + Intergenic
1053832182 9:42095166-42095188 GAGGAGAAGGTGGATAGGGAAGG - Intronic
1054145130 9:61556404-61556426 GGGCTGAAGTTGGAGGAGGAGGG - Intergenic
1054188486 9:61970583-61970605 GGGCTGAAGTTGGAGGAGGAGGG + Intergenic
1054464831 9:65487361-65487383 GGGCTGAAGTTGGAGGAGGAGGG - Intergenic
1054580515 9:66907961-66907983 GCGGAGATGTGGAAGAAGGAAGG + Intronic
1054650038 9:67618034-67618056 GGGCTGAAGTTGGAGGAGGAGGG - Intergenic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1055238306 9:74151601-74151623 CTAGAGAAGTTGGAGGAGGAGGG + Intergenic
1055277615 9:74636775-74636797 GTGGGGAATCTGGAGAAGAAGGG + Intronic
1055491400 9:76808579-76808601 GTGTAGGAGATGGAGAAGGCTGG - Intronic
1056463060 9:86826668-86826690 GTGGTGGTGTTGGGGAAGGAAGG - Intergenic
1056737283 9:89220510-89220532 ATGGAGAAGTTGGATAAGAGTGG - Intergenic
1056746516 9:89308708-89308730 GTAGAGAAGTTGATTAAGGAAGG + Intergenic
1057042539 9:91857935-91857957 GGGGTTAACTTGGAGAAGGAGGG + Intronic
1057383158 9:94586794-94586816 ATGGTGAAGTCGGTGAAGGAAGG - Intronic
1057392920 9:94654098-94654120 CTCGAGCAGGTGGAGAAGGATGG + Intergenic
1057530324 9:95839355-95839377 GTGGAGGAGTAAGACAAGGAAGG - Intergenic
1057786461 9:98091860-98091882 GTGGAGACGGTGGAGATGGTGGG - Intronic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1058151997 9:101473587-101473609 GTAGAGAAACTGGACAAGGAAGG + Exonic
1058475124 9:105325337-105325359 GGGGAGTAGTTGGACATGGAAGG + Intronic
1058580196 9:106447534-106447556 GTGGAGAAGGTGGAAGGGGAGGG - Intergenic
1058626538 9:106939251-106939273 GTGTGGAAGTTGGAGTGGGAAGG + Intronic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058788518 9:108416809-108416831 GTGATGAAGAAGGAGAAGGAAGG - Intergenic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1059715307 9:116907729-116907751 GTGGTGGAGGTGGTGAAGGATGG + Intronic
1060279010 9:122203578-122203600 GTGGAAGAGTTGTAGCAGGATGG + Exonic
1060894771 9:127210554-127210576 GGGGAGGAGTTGGGGAGGGAGGG + Intronic
1061025881 9:128049146-128049168 GTGGAGAAGTTGGCTGAGGGCGG + Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061764912 9:132875498-132875520 CTTGAGAACTTGGAGAAGGCTGG - Intronic
1061766158 9:132882707-132882729 AGGGAGATGTTGGAGATGGAAGG - Intronic
1061766737 9:132886341-132886363 GTTCACAAGGTGGAGAAGGAGGG - Intronic
1061865695 9:133490862-133490884 AAGGAGGAGTTGGAGGAGGATGG + Intergenic
1061865759 9:133491074-133491096 GAGGAGGAGTTGGAGGAGGAGGG + Intergenic
1061865785 9:133491149-133491171 GAGGAGGACTTGGAGGAGGAGGG + Intergenic
1061967582 9:134025059-134025081 GAGGAGGAGATGGAGGAGGAGGG - Intergenic
1062079840 9:134618052-134618074 GTGGAGTAGTTGGAGGAAGGGGG - Intergenic
1062159037 9:135069602-135069624 GGGGAGAGGTGGGAGGAGGAGGG + Intergenic
1062351652 9:136142569-136142591 GTGGGGAGGTTGGGGAGGGAGGG - Intergenic
1185499055 X:583980-584002 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1186064102 X:5742947-5742969 GAGGAGAAGGAGGAGAAGGAGGG + Intergenic
1186064106 X:5742956-5742978 GAGGAGAAGGAGGGGAAGGAGGG + Intergenic
1186209505 X:7234532-7234554 GAGTAGATGTTGGACAAGGAGGG + Intronic
1186532963 X:10316025-10316047 GTGTATAAGTTGGATAAGGGAGG + Intergenic
1186849780 X:13569376-13569398 GTTGAGAAGTCGAAGCAGGATGG - Intergenic
1186952132 X:14638181-14638203 TTGGAGAAGTATGAAAAGGAAGG + Intronic
1187552376 X:20318818-20318840 TTGGAGAACTGGGTGAAGGAAGG - Intergenic
1187615942 X:20993016-20993038 TTGCAGAAGCTGGGGAAGGAGGG + Intergenic
1188009170 X:25039515-25039537 GTGGGCAAGTTGTAGCAGGAAGG + Intergenic
1188119835 X:26291012-26291034 GTGGGCAAGGTGTAGAAGGAAGG + Intergenic
1188526682 X:31095052-31095074 GTGGAGAAGTGATACAAGGAGGG + Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189245473 X:39560247-39560269 GTGCAGAAGTGAGACAAGGAAGG - Intergenic
1189255092 X:39631779-39631801 GTGAAGAAATGTGAGAAGGAAGG + Intergenic
1189487473 X:41444514-41444536 GTGGAGAAGTGGGGAAAGAAAGG + Intergenic
1189617166 X:42795684-42795706 GTGGAGAAGTAAGACAGGGAAGG + Intergenic
1190024619 X:46912370-46912392 GAGGAGAGGTTGGGGGAGGAAGG + Intronic
1190126198 X:47707796-47707818 GTTGAGAAGATAGAGGAGGAGGG + Intergenic
1190291404 X:48995183-48995205 TGGGAGGAGTTGGAGGAGGAAGG + Intronic
1190444131 X:50505996-50506018 ATAGAGAAGTTGGAGAAAGTGGG + Intergenic
1190530236 X:51367785-51367807 GGGGAGAAGGTGGAGCAAGATGG + Intergenic
1190544566 X:51512221-51512243 GTTGAGAAGTTGGATAGGGCTGG - Intergenic
1191177178 X:57516803-57516825 GTGCACCAGTTGGAGAGGGAAGG + Intergenic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192191886 X:68996078-68996100 GTGGAGAAGCTGGGGCAGGGCGG + Intergenic
1192281435 X:69690684-69690706 TTGGAAGAGTTTGAGAAGGATGG + Intronic
1192481479 X:71490039-71490061 GTGGAGGGGGTGGAGGAGGAGGG - Intronic
1192747180 X:73950825-73950847 GTGGAAAAGATGGAGGAGGCAGG + Intergenic
1193650939 X:84130866-84130888 GGGGAGAATTTGGGGGAGGAGGG + Intronic
1194010997 X:88560810-88560832 GAGGAGAAGTTGGACAAACAAGG + Intergenic
1194025018 X:88740378-88740400 GTGCAGAAGTTGGAGGAGTTTGG - Intergenic
1194318460 X:92411915-92411937 GAGGAGGAGTGGGAGGAGGAGGG + Intronic
1194766201 X:97846969-97846991 GCGGAGAAGGTCGCGAAGGAGGG - Intergenic
1194858013 X:98957473-98957495 GGGGAGAAGATGGAGAAAGATGG - Intergenic
1194988120 X:100513270-100513292 GAGGGGAAGTTGGAAAGGGAGGG - Intergenic
1195038059 X:100988179-100988201 GTGGAGAAGCTGGTGGAAGATGG - Exonic
1195045633 X:101052085-101052107 GAGGAGAACTTAGAGAAGGAAGG - Intronic
1195232432 X:102863883-102863905 GTGGAGAAGTTTGACAATGGTGG + Intergenic
1195619176 X:106935953-106935975 CCTGAGAAGTTGGAGAGGGAAGG + Intronic
1196124221 X:112082344-112082366 GTGAAGGAGAGGGAGAAGGAGGG + Exonic
1196569145 X:117245327-117245349 GTGGAAATCTTGGAGAAGCATGG - Intergenic
1196738996 X:119007591-119007613 GAGGAGAGGTTGGAGATGCAAGG + Intronic
1196981616 X:121220659-121220681 GTGAAGAAGATGAAGAATGAGGG - Intergenic
1197902747 X:131391763-131391785 TTGGAAAATATGGAGAAGGAAGG - Intronic
1197917202 X:131548916-131548938 GTGAAGAAGTGGCAGAAGGAAGG - Intergenic
1197959389 X:131987751-131987773 TTGGGGAAGTGGGAGAAAGATGG - Intergenic
1198322454 X:135532005-135532027 GATGAGAAGTTGCAGAAGGAAGG + Intronic
1198428062 X:136539614-136539636 GTTTAGAAGTTGGAGAGAGAAGG - Intronic
1198704386 X:139432790-139432812 GTGGAGAGGAGGGAAAAGGAAGG - Intergenic
1198931978 X:141871854-141871876 GTGGAGAAGTAGGAGGGGCAAGG + Intronic
1199780773 X:151057277-151057299 ATGGAGAAGTTGTTAAAGGAAGG - Intergenic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1200626634 Y:5525220-5525242 GAGGAGGAGTGGGAGGAGGAGGG + Intronic
1201224742 Y:11807898-11807920 GAGGAGGAGGAGGAGAAGGAAGG - Intergenic
1201958593 Y:19652646-19652668 GTGGAGAAATTGGGGAAGTAGGG - Intergenic