ID: 1045826412

View in Genome Browser
Species Human (GRCh38)
Location 8:106403477-106403499
Sequence GTGGAGCTCTTCAAGAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045826410_1045826412 12 Left 1045826410 8:106403442-106403464 CCACAGTAAGGTCTGGTCTACAG 0: 1
1: 1
2: 6
3: 27
4: 139
Right 1045826412 8:106403477-106403499 GTGGAGCTCTTCAAGAATGATGG No data
1045826409_1045826412 13 Left 1045826409 8:106403441-106403463 CCCACAGTAAGGTCTGGTCTACA 0: 1
1: 1
2: 8
3: 25
4: 151
Right 1045826412 8:106403477-106403499 GTGGAGCTCTTCAAGAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045826412 Original CRISPR GTGGAGCTCTTCAAGAATGA TGG Intronic
No off target data available for this crispr