ID: 1045826490

View in Genome Browser
Species Human (GRCh38)
Location 8:106404100-106404122
Sequence CAACAACCTCAAGTGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045826490_1045826497 -1 Left 1045826490 8:106404100-106404122 CCCTCTACCACTTGAGGTTGTTG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1045826497 8:106404122-106404144 GGGGGACAAATCAATTCACCTGG No data
1045826490_1045826498 0 Left 1045826490 8:106404100-106404122 CCCTCTACCACTTGAGGTTGTTG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1045826498 8:106404123-106404145 GGGGACAAATCAATTCACCTGGG No data
1045826490_1045826505 24 Left 1045826490 8:106404100-106404122 CCCTCTACCACTTGAGGTTGTTG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1045826505 8:106404147-106404169 GTAGGGATGCTGCTACCACTGGG No data
1045826490_1045826500 2 Left 1045826490 8:106404100-106404122 CCCTCTACCACTTGAGGTTGTTG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1045826500 8:106404125-106404147 GGACAAATCAATTCACCTGGGGG No data
1045826490_1045826504 23 Left 1045826490 8:106404100-106404122 CCCTCTACCACTTGAGGTTGTTG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1045826504 8:106404146-106404168 GGTAGGGATGCTGCTACCACTGG No data
1045826490_1045826499 1 Left 1045826490 8:106404100-106404122 CCCTCTACCACTTGAGGTTGTTG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1045826499 8:106404124-106404146 GGGACAAATCAATTCACCTGGGG No data
1045826490_1045826502 7 Left 1045826490 8:106404100-106404122 CCCTCTACCACTTGAGGTTGTTG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1045826502 8:106404130-106404152 AATCAATTCACCTGGGGGTAGGG No data
1045826490_1045826506 29 Left 1045826490 8:106404100-106404122 CCCTCTACCACTTGAGGTTGTTG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1045826506 8:106404152-106404174 GATGCTGCTACCACTGGGTGTGG No data
1045826490_1045826501 6 Left 1045826490 8:106404100-106404122 CCCTCTACCACTTGAGGTTGTTG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1045826501 8:106404129-106404151 AAATCAATTCACCTGGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045826490 Original CRISPR CAACAACCTCAAGTGGTAGA GGG (reversed) Intronic
906442629 1:45862259-45862281 CAACAACCTTATAAGGTAGATGG + Intronic
908151521 1:61307313-61307335 CCACATCCTCACGTGGCAGAAGG - Intronic
908156420 1:61358292-61358314 GAACAACTCCAAGTGGAAGATGG + Intronic
909448552 1:75773938-75773960 CAAGACCCTGAAGTGGTATAAGG - Intronic
909877226 1:80822995-80823017 CAATACCCTCATGAGGTAGATGG + Intergenic
909904978 1:81183608-81183630 CATCATCCTCAAGTTGGAGAGGG - Intergenic
912622118 1:111172125-111172147 CTACAGCCTAAAGTTGTAGAGGG - Intronic
924346999 1:243082047-243082069 CAAGAACCACAAATGGAAGAAGG + Intergenic
1068011217 10:51454477-51454499 CAAAAACATCAAGTGGCAAAAGG + Intronic
1071240241 10:83697191-83697213 AAACAACCTCATGTGTTAGCTGG - Intergenic
1071769969 10:88717451-88717473 CAACAACCTCATGAGGAAGGTGG + Intergenic
1072032859 10:91538021-91538043 CAACAACCTCATGTGACTGATGG + Intergenic
1073091831 10:100948041-100948063 CAACCACCCTAAGTGGTGGAGGG - Intronic
1076220506 10:128729797-128729819 CATCAACCTCCTGTGGCAGAAGG - Intergenic
1078843645 11:15102220-15102242 CTACATCCTCATGTGGCAGAAGG + Intergenic
1079286975 11:19143501-19143523 CTACAACCTGAATAGGTAGATGG + Intronic
1081880420 11:46445781-46445803 TAACAACCCCAAATGATAGAAGG + Intronic
1084118955 11:67057746-67057768 CAACAACCCCATGGGGTAGAGGG + Intronic
1087466592 11:98515474-98515496 CAACACCCTCAATGGGTTGAAGG - Intergenic
1093285163 12:17250840-17250862 CAACAACCCCAAGTGCTGGTGGG + Intergenic
1095704302 12:45220984-45221006 CAAGAACCTCAATTTGTAGCCGG + Intronic
1096562998 12:52450485-52450507 CAACAACCTCAGGAGGCAGCTGG - Exonic
1096565151 12:52472145-52472167 CAACAACCTCAGGAGGCAGCTGG - Exonic
1096567168 12:52491601-52491623 CAACAACCTCAGGAGGCAGCTGG - Exonic
1096570261 12:52519025-52519047 CAACAACCTCAGGAGGCAGCTGG - Exonic
1096963561 12:55605016-55605038 AAACAACCTCAAGTGGGCAAAGG + Intergenic
1097615487 12:61879754-61879776 CAACAACCTTAGGTGGCAGCTGG + Intronic
1098300428 12:69048529-69048551 CTGTAACCTCATGTGGTAGAGGG + Intergenic
1100762703 12:97826888-97826910 CTATAACCTCATGTGGCAGAAGG - Intergenic
1101534250 12:105602872-105602894 CATCAACCCCAGGAGGTAGATGG + Intergenic
1107364810 13:39658671-39658693 AAAGACCCTAAAGTGGTAGAAGG - Intronic
1108869674 13:54968047-54968069 CAACCACATAAAGTGGTATATGG - Intergenic
1114630259 14:24155017-24155039 TAACAACCTCAAGTGCCAGCAGG - Intronic
1115712469 14:36066054-36066076 CCACATCCTCACGTGGTGGAAGG - Intergenic
1118192183 14:63590838-63590860 CAACAACATCCAGTGGAAGAGGG - Intergenic
1118710466 14:68514612-68514634 CAAAAACCCCAAGTGGAAAATGG - Intronic
1120991363 14:90380314-90380336 CAGCATCCTCACGTGGCAGAAGG - Intergenic
1125841108 15:42801959-42801981 CAACAACCTTAAGTGGCAGCTGG - Intronic
1127542313 15:59952894-59952916 CTCTAACCTCAAATGGTAGAAGG + Intergenic
1128842159 15:70859144-70859166 CAACAACCTTAGGTGGCAGCTGG + Intronic
1131704832 15:94982315-94982337 AAAGAACCTCAAGAGGTACACGG + Intergenic
1133410481 16:5564357-5564379 CAACATCATCAAATGGCAGAAGG - Intergenic
1140520130 16:75573895-75573917 AAACAATCTCATGAGGTAGATGG - Intronic
1140837699 16:78810486-78810508 CAAGAATCTCAAGTGATACAGGG - Intronic
1143414778 17:6738291-6738313 CAACCCTCTCAAGTGGTAGAAGG - Intergenic
1144833174 17:18143003-18143025 CCACAATCCCAAGGGGTAGATGG - Intronic
1146018570 17:29253926-29253948 CTGCAACCTAAAGTGGTAGTTGG - Intronic
1148907523 17:50920688-50920710 CAGCAACCTTGAGTGGGAGAAGG + Intergenic
1149121094 17:53166302-53166324 GAACATACTCTAGTGGTAGAGGG - Intergenic
1155310037 18:24514537-24514559 CAACAACCCCTAGTGGTGAAAGG - Intergenic
1159419872 18:68204437-68204459 CAAAATCTTCAAATGGTAGAGGG + Intergenic
1159526558 18:69599514-69599536 CAATTTCCTCAAGGGGTAGATGG - Intronic
1165829696 19:38724318-38724340 CATCAACTCCAAGTGGGAGAAGG + Exonic
926866392 2:17363654-17363676 CTACATCCTCATGTGGTAGAAGG - Intergenic
930510985 2:52345136-52345158 CAATAACCTCAAATTGTAGCAGG - Intergenic
931927408 2:67088272-67088294 CAACAACATCAAATGCTAAAGGG - Intergenic
934122680 2:88855419-88855441 CAACATTCTCAAGAGGCAGAAGG + Intergenic
936125665 2:109787495-109787517 CTAGAACCTCAAGGGGTGGACGG + Intergenic
936219028 2:110583973-110583995 CTAGAACCTCAAGGGGTGGACGG - Intergenic
937621853 2:123997601-123997623 CAAGAACCACATGTGGCAGAAGG + Intergenic
939643600 2:144669877-144669899 CAGCAAGCCCAAGTGGGAGAAGG - Intergenic
940372777 2:152921401-152921423 CTGCAACCTCACATGGTAGAAGG + Intergenic
940666064 2:156611355-156611377 CAACAACCCTAAGAGGTAGGCGG - Intronic
943621831 2:190157125-190157147 CCACAACCTTATGTGGTAGGTGG + Intronic
945100847 2:206261068-206261090 CAACAAACTCCACTGGTACACGG - Intergenic
946700810 2:222411412-222411434 CACCAACCTCATGAGGTAGGTGG - Intergenic
1169904378 20:10586173-10586195 TAACAAAGTCAAGTGGGAGAAGG - Intronic
1170316158 20:15043441-15043463 CAAAAAACTCAAGTGGGTGAAGG - Intronic
1173596444 20:44261573-44261595 CCAGAAGCTCAAGTGTTAGAGGG + Intronic
1175086801 20:56466399-56466421 CAATAACCTTAAGAGTTAGAAGG - Intergenic
1177182857 21:17762007-17762029 CAACATCCTCACATGGTGGAAGG - Intergenic
1179177422 21:39019128-39019150 CAACACCCTAAAATGGGAGAAGG - Intergenic
1182774548 22:32821180-32821202 CAACTAACTCCAGTGGTAAAAGG - Intronic
1183804533 22:40196911-40196933 CAACAACCTGATGTGGAGGATGG + Intronic
1185006109 22:48277919-48277941 CAGCAACCTCCAGTGGCAGGAGG - Intergenic
949741141 3:7236061-7236083 CTGCATCCTCATGTGGTAGAAGG + Intronic
954590433 3:51777820-51777842 CAATGACCTCCAGTGGCAGAGGG + Intergenic
954594620 3:51814071-51814093 CAATGACCTCCAGTGGCAGAGGG - Intergenic
954937186 3:54337286-54337308 CAACAACCTCATGAGGTAGGTGG + Intronic
955587807 3:60500199-60500221 CAACATCATCAATTGGTAAACGG - Intronic
955839563 3:63097354-63097376 CAACAACCTTAGGTGGCAGCTGG - Intergenic
956080737 3:65552956-65552978 CAAAAACCTCAAGTTGCAGGAGG - Intronic
956191442 3:66612038-66612060 CCACAACCTCAGGTGGAAGAGGG + Intergenic
962101385 3:132346376-132346398 CAACAACCTCATGTCGTTAATGG - Intronic
963321097 3:143810467-143810489 CAACATTCTCAAGTGGTAGCTGG + Intronic
964203618 3:154146200-154146222 CTACATCTTCACGTGGTAGAAGG + Intronic
967870745 3:194226893-194226915 CCGTAACCTCACGTGGTAGAAGG - Intergenic
974677411 4:65111426-65111448 CAACAATCTCACATGGCAGATGG - Intergenic
976737539 4:88325784-88325806 TCACAATATCAAGTGGTAGAGGG - Intergenic
977125077 4:93155261-93155283 GAACATCCTCATGTGGTAGTGGG - Intronic
978607559 4:110498356-110498378 AAAAAACCTCAAGAGGTAAATGG + Intronic
981019148 4:140006902-140006924 CACCTACCTCAAGGGGTTGACGG - Intronic
981642747 4:146964047-146964069 CCACATCCTCATGTGGTAGAAGG + Intergenic
981748657 4:148073358-148073380 CAACAACCTCTTGGGGAAGAGGG + Intergenic
983656302 4:170088878-170088900 CTGCATCCTCACGTGGTAGAAGG - Intronic
983980087 4:173984912-173984934 CATCAACGCCAACTGGTAGAGGG - Intergenic
985591569 5:768130-768152 CAACAGCCCCAAGAGGAAGAGGG + Intergenic
985609485 5:879089-879111 CAACAGCCCCAAGAGGAAGAGGG + Intronic
988989868 5:36660118-36660140 GAACAAACACAATTGGTAGATGG - Intronic
990532803 5:56690347-56690369 CAGCAGGCCCAAGTGGTAGAAGG + Intergenic
991377863 5:65984974-65984996 AAACAATCTCAAGTAGTGGATGG + Intronic
994260716 5:97655428-97655450 ATACAACCTCACGTGGCAGAAGG - Intergenic
998173544 5:139886366-139886388 CCACAACAAAAAGTGGTAGAAGG - Intronic
998227016 5:140334979-140335001 CAACATCCTTATGAGGTAGATGG + Intronic
999352064 5:150881725-150881747 CAACAACAACATGTGGGAGAGGG + Intronic
1001187120 5:169584811-169584833 CAACAACTTCAAGAGGTTGAAGG - Intronic
1002842897 6:921631-921653 CAACATCCACAAGTGGTTGCGGG + Intergenic
1004878947 6:19986323-19986345 CAAAATCCTCAAGAGATAGATGG + Intergenic
1014502521 6:122210004-122210026 CAACTGGCCCAAGTGGTAGAGGG + Intergenic
1014609944 6:123530020-123530042 GCACAGCCTCAAGAGGTAGATGG - Intronic
1015576203 6:134673820-134673842 CAACAAGCTCACTTGATAGACGG + Intergenic
1016701839 6:147063257-147063279 TAACCACCAAAAGTGGTAGAAGG + Intergenic
1021547661 7:21833297-21833319 AAACAACCTGAAATGATAGAAGG + Intronic
1026613326 7:71880225-71880247 CATCAACCTAAAGTGAAAGAGGG + Intronic
1027600258 7:80231380-80231402 CAACAAAAGCAAGTTGTAGAAGG - Intergenic
1028400692 7:90422245-90422267 CAATAACACCAAGAGGTAGAAGG - Intronic
1038602682 8:28962665-28962687 CCACAACATCAAGGTGTAGAGGG - Intronic
1042897859 8:73691177-73691199 CCACAAACTCAAGAGGTAAAAGG + Intronic
1044181472 8:89200847-89200869 CTCCAAACTCAAGTGGTAAAAGG + Intergenic
1045826490 8:106404100-106404122 CAACAACCTCAAGTGGTAGAGGG - Intronic
1045859768 8:106803095-106803117 CCATAACCTCACATGGTAGAAGG + Intergenic
1048908042 8:139107272-139107294 CAAGAACCTTAAATGGTGGAAGG + Intergenic
1056305448 9:85286451-85286473 CAACAACCTCAGGTGAGAAATGG + Intergenic
1056685542 9:88756032-88756054 AAGCAACCTCAAGGGGTAAATGG - Intergenic
1057145216 9:92754249-92754271 CAGCTACCTGAGGTGGTAGAAGG + Intronic
1059962339 9:119577650-119577672 CCAGAATCTCAAGTGGTAGCAGG + Intergenic
1061475463 9:130862903-130862925 CAACTACGACAAGTGGGAGATGG + Exonic
1062678831 9:137765318-137765340 TAACAACCTCTAGTGGTATCCGG + Intronic
1186689701 X:11962282-11962304 CCACATCCTCACATGGTAGAAGG + Intergenic
1186890404 X:13954027-13954049 CTGTATCCTCAAGTGGTAGAAGG + Intergenic
1189752305 X:44234820-44234842 CAACAACCTCAACAGACAGAAGG + Intronic
1191164533 X:57373978-57374000 CAAAAACCTAAAGTGGGAAAAGG - Intronic
1191220682 X:57985114-57985136 CAACAACCTTAGGTGGCAGCTGG + Intergenic
1192084383 X:68081424-68081446 CAACAACCCTATGAGGTAGATGG - Intronic
1194347266 X:92781589-92781611 CAAAAACATAAAGTGGGAGAAGG + Intergenic
1200083241 X:153589757-153589779 CTACAACCTCAGGTAGGAGATGG + Intronic