ID: 1045826491

View in Genome Browser
Species Human (GRCh38)
Location 8:106404101-106404123
Sequence CCAACAACCTCAAGTGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045826491_1045826497 -2 Left 1045826491 8:106404101-106404123 CCTCTACCACTTGAGGTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1045826497 8:106404122-106404144 GGGGGACAAATCAATTCACCTGG No data
1045826491_1045826501 5 Left 1045826491 8:106404101-106404123 CCTCTACCACTTGAGGTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1045826501 8:106404129-106404151 AAATCAATTCACCTGGGGGTAGG No data
1045826491_1045826504 22 Left 1045826491 8:106404101-106404123 CCTCTACCACTTGAGGTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1045826504 8:106404146-106404168 GGTAGGGATGCTGCTACCACTGG No data
1045826491_1045826502 6 Left 1045826491 8:106404101-106404123 CCTCTACCACTTGAGGTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1045826502 8:106404130-106404152 AATCAATTCACCTGGGGGTAGGG No data
1045826491_1045826500 1 Left 1045826491 8:106404101-106404123 CCTCTACCACTTGAGGTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1045826500 8:106404125-106404147 GGACAAATCAATTCACCTGGGGG No data
1045826491_1045826498 -1 Left 1045826491 8:106404101-106404123 CCTCTACCACTTGAGGTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1045826498 8:106404123-106404145 GGGGACAAATCAATTCACCTGGG No data
1045826491_1045826506 28 Left 1045826491 8:106404101-106404123 CCTCTACCACTTGAGGTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1045826506 8:106404152-106404174 GATGCTGCTACCACTGGGTGTGG No data
1045826491_1045826499 0 Left 1045826491 8:106404101-106404123 CCTCTACCACTTGAGGTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1045826499 8:106404124-106404146 GGGACAAATCAATTCACCTGGGG No data
1045826491_1045826505 23 Left 1045826491 8:106404101-106404123 CCTCTACCACTTGAGGTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1045826505 8:106404147-106404169 GTAGGGATGCTGCTACCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045826491 Original CRISPR CCAACAACCTCAAGTGGTAG AGG (reversed) Intronic
900702861 1:4058870-4058892 CCCACAACCACATGTGGGAGGGG - Intergenic
901662548 1:10807658-10807680 CCAACCTTCTCAAGTGATAGAGG - Intergenic
902788841 1:18751365-18751387 CCAACAACCCCAAATGTTGGTGG + Intergenic
904570262 1:31459022-31459044 CAAACAACCTCACGTGCTTGAGG - Intergenic
905516320 1:38564628-38564650 CCAACAGTCCCAAGTGGCAGAGG + Intergenic
907697390 1:56745983-56746005 TCAAAAACCTCAAGTAGTTGAGG - Intronic
912225743 1:107732419-107732441 CCAAGAAGCTCAAGGGGTTGGGG + Intronic
915126830 1:153671435-153671457 CCATCAACTTCAACTGCTAGTGG - Intergenic
921728864 1:218554363-218554385 GCACAAACCTCAAGTGGAAGTGG + Intergenic
1067458331 10:46439454-46439476 CCAGCAACCCCATGTGGCAGTGG + Intergenic
1067628867 10:47945180-47945202 CCAGCAACCCCATGTGGCAGTGG - Intergenic
1067691935 10:48507744-48507766 CTCACAACCTCAAGTGGGGGCGG + Intronic
1071580462 10:86764756-86764778 TCAACAGCCACATGTGGTAGTGG - Intronic
1076634399 10:131873039-131873061 AGAACAACCTCAAGTGGCTGTGG + Intergenic
1080292442 11:30686143-30686165 ACAACAGCGTTAAGTGGTAGAGG - Intergenic
1082791137 11:57347501-57347523 CCCACAATCCCAAGTGTTAGTGG + Intronic
1083209877 11:61176588-61176610 CAGACAACCTCGAGGGGTAGTGG + Intergenic
1083781054 11:64917517-64917539 CCAACCACTTTAAGTGGTTGGGG + Intergenic
1084118954 11:67057745-67057767 ACAACAACCCCATGGGGTAGAGG + Intronic
1087015927 11:93554747-93554769 CCCAGACCCTCAAGTGGGAGCGG - Intergenic
1088572198 11:111233216-111233238 CCAAGAAACTCAAGAGGCAGAGG - Intergenic
1093285162 12:17250839-17250861 ACAACAACCCCAAGTGCTGGTGG + Intergenic
1095596738 12:43967600-43967622 CCAACAACCTCATGAGGGAGTGG + Intronic
1101694588 12:107113069-107113091 CCAATAGCTACAAGTGGTAGTGG - Intergenic
1102047538 12:109839436-109839458 CCTACAACCTGAAGAGGCAGGGG - Intergenic
1104869169 12:131982283-131982305 ACAGCAGCCGCAAGTGGTAGAGG + Exonic
1109472445 13:62826980-62827002 CAAACATCCTCAGGGGGTAGGGG - Intergenic
1109474684 13:62863742-62863764 CCAAGAACTTCAAATTGTAGTGG - Intergenic
1109669391 13:65585352-65585374 CCAGGAAGCTCAAGTGGTCGCGG + Intergenic
1113063467 13:106350153-106350175 TTAACATCTTCAAGTGGTAGAGG + Intergenic
1118192184 14:63590839-63590861 TCAACAACATCCAGTGGAAGAGG - Intergenic
1130812896 15:87400515-87400537 TCAGCAAACTCAAGTGGAAGGGG + Intergenic
1140837700 16:78810487-78810509 CCAAGAATCTCAAGTGATACAGG - Intronic
1144023129 17:11254620-11254642 CCAACTGCCTCCAGAGGTAGGGG - Intronic
1151918310 17:77135135-77135157 CCAACAGTGTCAAGTGGTATGGG - Intronic
1153511018 18:5852635-5852657 ACAAAATCCTCAAATGGTAGGGG - Intergenic
1162503229 19:11066628-11066650 CCAACAACCCCAAGGGCTGGGGG + Intergenic
1166324809 19:42042623-42042645 CCACCAACCGCAGGCGGTAGCGG + Exonic
1166681134 19:44767850-44767872 CCATCAACCCCAAGGGGTCGGGG - Intergenic
928227104 2:29459616-29459638 CAAACAACTTCCAGAGGTAGAGG + Intronic
929801819 2:45110940-45110962 CCAACTACCTCATGAGGCAGTGG - Intergenic
934011784 2:87827254-87827276 CCATAAACCTCAAGGGGTAGAGG - Intergenic
935087003 2:99857977-99857999 CAACCAAACTCAAGGGGTAGGGG - Intronic
936384064 2:112012961-112012983 CCAACAACGTCAGCTGGAAGTGG - Intronic
942722152 2:178965506-178965528 CCAGGAAGCACAAGTGGTAGGGG + Intronic
943739262 2:191393322-191393344 CCAACAACCTCATGAGATAATGG + Intronic
945243064 2:207694227-207694249 CCAACAACCTTATGAGATAGGGG - Intergenic
946528892 2:220550258-220550280 CCAACAAGCTCAAGCGAAAGGGG - Intergenic
946774763 2:223126019-223126041 TGAAAAACCTCAAGTGGTAGAGG - Intronic
948541299 2:238693095-238693117 CCAACCACCCCATGAGGTAGTGG + Intergenic
1168996848 20:2139639-2139661 CCAGCAACCCTAAGAGGTAGGGG - Intronic
1173813254 20:45969137-45969159 CCAATAACCCCAAAAGGTAGAGG - Intronic
1176069646 20:63219349-63219371 GCAGCACCCTCAAGTGGTATGGG + Intergenic
1177404945 21:20654584-20654606 GCAACGACCTCAAGAGTTAGTGG + Intergenic
1178096770 21:29223395-29223417 CAAACACCCTGAAGTGGGAGGGG + Intronic
1178970233 21:37168717-37168739 CAAACAACCTCAAAAGCTAGTGG + Intronic
1179334765 21:40440355-40440377 TCAGCAACCTCATGTGGTATAGG - Intronic
1179334789 21:40440578-40440600 TCAGCAACCTCATGTGGTATAGG - Intronic
1179334813 21:40440801-40440823 TCAGCAACCTCATGTGGTATAGG - Intronic
1182868040 22:33622082-33622104 CTAACAACCTCCAGTGGGGGTGG - Intronic
1185118192 22:48949913-48949935 CAAAAAACCTCAAGAGGAAGAGG - Intergenic
954590432 3:51777819-51777841 CCAATGACCTCCAGTGGCAGAGG + Intergenic
954594621 3:51814072-51814094 CCAATGACCTCCAGTGGCAGAGG - Intergenic
956191440 3:66612037-66612059 TCCACAACCTCAGGTGGAAGAGG + Intergenic
956813032 3:72883219-72883241 CCAACAACCCCATGTGGCTGTGG - Intergenic
965137428 3:164789270-164789292 CCATCAACTTCAAGTTGTGGGGG - Intergenic
975396660 4:73882593-73882615 CCAACAACCTGGATTGGCAGTGG - Intergenic
975412794 4:74074350-74074372 CCAACAATCTGAATTGGGAGTGG + Intergenic
976737540 4:88325785-88325807 CTCACAATATCAAGTGGTAGAGG - Intergenic
977125078 4:93155262-93155284 AGAACATCCTCATGTGGTAGTGG - Intronic
978654412 4:111049243-111049265 CCACCAGCCTGAGGTGGTAGTGG + Intergenic
980527302 4:134008021-134008043 TAAACATCCTCAAGTGATAGTGG + Intergenic
983772704 4:171570972-171570994 CCAACACTATCAAGTGGAAGGGG + Intergenic
985035657 4:185837922-185837944 CAAAAAACTTCAAGTGGAAGAGG - Intronic
991550463 5:67830431-67830453 TCAACAATCTCAAATGGAAGTGG + Intergenic
991915600 5:71601819-71601841 CCAACAACCACAGCTGGTTGGGG - Intronic
997422964 5:133783721-133783743 CCAGCATCCTCAAGTGGTTTGGG + Intergenic
999267763 5:150278117-150278139 CCAACAAACCCAGGAGGTAGAGG - Intronic
1002842896 6:921630-921652 CCAACATCCACAAGTGGTTGCGG + Intergenic
1006715848 6:36119856-36119878 CCAACAACCTTAAGTGAAAAAGG + Intergenic
1009309876 6:62136720-62136742 CCAAGAATCTCATGTGATAGTGG - Intronic
1014502520 6:122210003-122210025 CCAACTGGCCCAAGTGGTAGAGG + Intergenic
1014608692 6:123513184-123513206 CCCATAATCCCAAGTGGTAGTGG - Intronic
1015606963 6:134967770-134967792 ACACAAAGCTCAAGTGGTAGAGG - Intronic
1015857315 6:137638969-137638991 CCAACAACCTGAAGGAGTACAGG - Intergenic
1017236605 6:152122834-152122856 CCAACAACCTCATTTGATGGTGG - Intronic
1018547362 6:164952392-164952414 CCCAGAACCTCAACTGGTAAGGG - Intergenic
1023054568 7:36281146-36281168 CCAACATCCGCAAGTGGAAGGGG + Exonic
1030909549 7:115229681-115229703 CCATCAACCACAAGTGCAAGTGG + Intergenic
1039006010 8:33037811-33037833 CCAACCACCTCAGGAGGCAGTGG + Intergenic
1039580106 8:38658704-38658726 CCAACAGCCTCATGAGTTAGTGG + Intergenic
1039678775 8:39704752-39704774 CCAAAAACCACAAATGTTAGAGG - Intronic
1045826491 8:106404101-106404123 CCAACAACCTCAAGTGGTAGAGG - Intronic
1049257483 8:141621615-141621637 CCAACAACCTCAAAAGGCAAAGG - Intergenic
1051560853 9:18438667-18438689 CCAACAACAGCAAATGGTGGCGG - Intergenic
1055169794 9:73242267-73242289 CCAAGAACCTCAAGTTGTGCTGG - Intergenic
1058933169 9:109742602-109742624 CTAACAACCTCAAGTGGAAATGG - Intronic
1059291185 9:113225500-113225522 ACAACAACCTCATGTTCTAGGGG - Intronic
1062030251 9:134358925-134358947 CCAACAGCCCCACGTGGCAGGGG + Intronic
1062044271 9:134417891-134417913 CCAACAGCCTCAAGGGGAGGAGG + Intronic
1192633431 X:72794338-72794360 CGAACAACCTCACATGGTTGTGG - Intronic
1192648278 X:72926463-72926485 CGAACAACCTCACATGGTTGTGG + Intronic
1193068525 X:77282708-77282730 CCAGCAAGCACAAGAGGTAGGGG + Intergenic
1195377120 X:104238842-104238864 TCAAAAATGTCAAGTGGTAGGGG - Intergenic
1198121573 X:133597812-133597834 CCAACAACCTCTAATGGTATTGG + Intronic
1198575123 X:138002147-138002169 CCAACAACATCAAGTAGTGTTGG - Intergenic
1199132700 X:144211288-144211310 CCATAAACCTCAAGGGGTAGAGG + Intergenic
1199581130 X:149361439-149361461 GCAACAACCTCAACTGGTCATGG - Intergenic
1201222593 Y:11786492-11786514 CCAACAAACACAAGTGATGGTGG + Intergenic