ID: 1045826496

View in Genome Browser
Species Human (GRCh38)
Location 8:106404107-106404129
Sequence TGTCCCCCAACAACCTCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 144}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045826496_1045826502 0 Left 1045826496 8:106404107-106404129 CCACTTGAGGTTGTTGGGGGACA 0: 1
1: 0
2: 3
3: 13
4: 144
Right 1045826502 8:106404130-106404152 AATCAATTCACCTGGGGGTAGGG No data
1045826496_1045826505 17 Left 1045826496 8:106404107-106404129 CCACTTGAGGTTGTTGGGGGACA 0: 1
1: 0
2: 3
3: 13
4: 144
Right 1045826505 8:106404147-106404169 GTAGGGATGCTGCTACCACTGGG No data
1045826496_1045826506 22 Left 1045826496 8:106404107-106404129 CCACTTGAGGTTGTTGGGGGACA 0: 1
1: 0
2: 3
3: 13
4: 144
Right 1045826506 8:106404152-106404174 GATGCTGCTACCACTGGGTGTGG No data
1045826496_1045826498 -7 Left 1045826496 8:106404107-106404129 CCACTTGAGGTTGTTGGGGGACA 0: 1
1: 0
2: 3
3: 13
4: 144
Right 1045826498 8:106404123-106404145 GGGGACAAATCAATTCACCTGGG No data
1045826496_1045826500 -5 Left 1045826496 8:106404107-106404129 CCACTTGAGGTTGTTGGGGGACA 0: 1
1: 0
2: 3
3: 13
4: 144
Right 1045826500 8:106404125-106404147 GGACAAATCAATTCACCTGGGGG No data
1045826496_1045826501 -1 Left 1045826496 8:106404107-106404129 CCACTTGAGGTTGTTGGGGGACA 0: 1
1: 0
2: 3
3: 13
4: 144
Right 1045826501 8:106404129-106404151 AAATCAATTCACCTGGGGGTAGG No data
1045826496_1045826497 -8 Left 1045826496 8:106404107-106404129 CCACTTGAGGTTGTTGGGGGACA 0: 1
1: 0
2: 3
3: 13
4: 144
Right 1045826497 8:106404122-106404144 GGGGGACAAATCAATTCACCTGG No data
1045826496_1045826504 16 Left 1045826496 8:106404107-106404129 CCACTTGAGGTTGTTGGGGGACA 0: 1
1: 0
2: 3
3: 13
4: 144
Right 1045826504 8:106404146-106404168 GGTAGGGATGCTGCTACCACTGG No data
1045826496_1045826499 -6 Left 1045826496 8:106404107-106404129 CCACTTGAGGTTGTTGGGGGACA 0: 1
1: 0
2: 3
3: 13
4: 144
Right 1045826499 8:106404124-106404146 GGGACAAATCAATTCACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045826496 Original CRISPR TGTCCCCCAACAACCTCAAG TGG (reversed) Intronic
901845362 1:11978720-11978742 TTGCCACAAACAACCTCAAGAGG - Intergenic
902664334 1:17927057-17927079 TTTCTCACAACAACCTCATGAGG + Intergenic
904165175 1:28549849-28549871 TGTCTCCCAACAACCCCAGAGGG - Intergenic
904325295 1:29724154-29724176 CCTCCCCCAACAACTCCAAGAGG + Intergenic
906611298 1:47205482-47205504 ACTCCCCCAACAAACCCAAGAGG - Intergenic
907738565 1:57140373-57140395 TGTCCTCCTAGAACCTAAAGGGG + Intronic
910352854 1:86319377-86319399 GGTACCCCAACAACCTCAGTGGG + Intergenic
911043122 1:93607636-93607658 TGTTCCCCAACCACCTCTATGGG + Intronic
912759894 1:112357628-112357650 TGTCCCCCAAGGCCCTGAAGGGG - Intergenic
913973668 1:143436611-143436633 TGTCCCCAAAAGACCTCAGGGGG - Intergenic
914068056 1:144262218-144262240 TGTCCCCAAAAGACCTCAGGGGG - Intergenic
914111099 1:144704136-144704158 TGTCCCCAAAAGACCTCAGGGGG + Intergenic
916005151 1:160653316-160653338 CTTCCCCAAAAAACCTCAAGTGG + Intergenic
916140238 1:161690646-161690668 TATCCCCCAAAAAGTTCAAGGGG - Intergenic
916781641 1:168037208-168037230 TGTGCTCCAACATCTTCAAGAGG + Intronic
920442783 1:205992503-205992525 TGTTCCCCAACAACACCATGGGG + Exonic
921095009 1:211878863-211878885 TGTGCCCCAACAACTTTCAGTGG - Intergenic
922445908 1:225697147-225697169 GGTCTCACAACAACCTCAGGAGG - Intergenic
1063842398 10:10087704-10087726 TGTCTCCCATCATCCTCAAATGG - Intergenic
1064280182 10:13944370-13944392 TGTCTCCCATCACCCTCAGGTGG + Intronic
1064359695 10:14652897-14652919 TTTCTCCCAACAACCTGAAAGGG - Intronic
1065261541 10:23928677-23928699 ATGCCCCCAACAACCTCATGAGG + Intronic
1065946586 10:30610536-30610558 TTTCCCCCAACCCCCTCAACAGG - Intergenic
1067061272 10:43079051-43079073 TGCTCCCCAACCACCCCAAGGGG + Intronic
1070515252 10:77199500-77199522 TTTCTCTCAACAACCTCAGGAGG - Intronic
1070873169 10:79776437-79776459 TGTCCCTCAAAATCCCCAAGGGG + Intergenic
1071655139 10:87439358-87439380 TGTCCCTCAAAATCCCCAAGGGG - Intergenic
1074591686 10:114820171-114820193 ATTCCCACAACAACCTCAAGAGG + Intergenic
1074859848 10:117501859-117501881 TGTCCACCCAGAACCTCAGGTGG + Intergenic
1076991793 11:279536-279558 TGGCCCGCAAGACCCTCAAGAGG + Exonic
1077485323 11:2835857-2835879 TGTCTCCCAACAGCCCCACGAGG - Intronic
1079400137 11:20100275-20100297 TGGTCCTCAACAACATCAAGTGG - Intronic
1079420665 11:20284485-20284507 TGACCCCCAAAAGCATCAAGTGG - Intergenic
1084026657 11:66454724-66454746 TTTCCCCCATCAACCAAAAGAGG - Intronic
1084150267 11:67284940-67284962 TGTTCCCCAACCGCCTCGAGTGG + Exonic
1084859378 11:72008091-72008113 TGTCCCCCAACAACCCTCTGAGG - Intronic
1087074974 11:94120367-94120389 TCTCCCCCTACAACTTGAAGGGG - Intergenic
1087624507 11:100581635-100581657 AGGCCCCCACCAACCTCATGAGG + Intergenic
1089844287 11:121446313-121446335 TTTCCCCCAACTACCCCTAGAGG - Intergenic
1096711091 12:53456755-53456777 TTTCCCCCACCAACCTTCAGAGG + Intronic
1097717488 12:62982101-62982123 TGTCCCCTAAAAATCTCATGTGG - Intergenic
1097893819 12:64804724-64804746 TCTGCCCCAAAAACCTCAAGTGG - Intronic
1103210091 12:119159238-119159260 TGTCCCCCAGGAACCTCACAGGG + Exonic
1104580317 12:130006743-130006765 TCTCCCCCTCCACCCTCAAGGGG - Intergenic
1110457673 13:75708637-75708659 TGTTCCAAAACAAACTCAAGGGG - Intronic
1112140646 13:96637925-96637947 TGTCCCTCAACAACCCTAAGTGG - Intronic
1113367785 13:109692801-109692823 TGTCCCCAAACACCCTCAGTGGG - Intergenic
1113433419 13:110269745-110269767 TGGACACCATCAACCTCAAGAGG + Intronic
1114401932 14:22418082-22418104 TGACCACCAACAACCACATGGGG + Intergenic
1118107337 14:62674928-62674950 TATCTCCCAAAAACCTGAAGTGG + Intergenic
1118721473 14:68597312-68597334 TGTCCCCTAACAACCAGGAGTGG - Intronic
1118798642 14:69168617-69168639 TGGCCCCCAAAATCCTCTAGTGG + Intergenic
1119998331 14:79277607-79277629 AAACCCCCAACAACCTCGAGAGG + Intronic
1129980284 15:79863117-79863139 TGTCCCTCAACAGCCTCAAGTGG + Intronic
1135323530 16:21512197-21512219 TGTTCCCCAGCAACCCCTAGGGG - Intergenic
1136335020 16:29605462-29605484 TGTTCCCCAGCAACCCCTAGGGG - Intergenic
1136598743 16:31269817-31269839 TGTCCCCAAACAACCTCAATGGG + Intronic
1138591453 16:58001434-58001456 GGTCCACCAGCAACCTCAACCGG - Exonic
1140133997 16:72189143-72189165 ATTCTCCCAACAACCTCCAGAGG + Intergenic
1140862278 16:79028306-79028328 TGTCACCCAACTACATCCAGGGG - Intronic
1145220712 17:21086061-21086083 TGTCTCCCAACAGCAGCAAGAGG - Intergenic
1146546909 17:33747976-33747998 TGGCCCTCAACAACCTCAAGTGG + Intronic
1146845731 17:36181006-36181028 TGTCTCCCATCACCCCCAAGTGG - Intronic
1146873949 17:36392883-36392905 TGTCTCCCATCACCCCCAAGTGG - Intronic
1147065441 17:37919990-37920012 TGTCTCCCATCACCCCCAAGTGG + Intergenic
1149420526 17:56506499-56506521 TCTCCCCCTAGAACCTCCAGAGG + Intronic
1149626054 17:58082007-58082029 TGTCCTCTAACAACCTCAGTTGG - Intergenic
1150163990 17:62924070-62924092 TGTTCCCCCACAGCCTGAAGGGG - Intergenic
1150625153 17:66836604-66836626 TGTCCCCCAGCTACCTCCAGGGG - Intronic
1151180574 17:72324699-72324721 TGTTTCCCTACAACCTCATGAGG + Intergenic
1155436821 18:25821295-25821317 TGTGCCACATCAACGTCAAGTGG + Intergenic
1156738712 18:40297470-40297492 TGTCCTAGAACAACCTCAAGAGG - Intergenic
1158858365 18:61567246-61567268 TCTCCCCCAACACCTCCAAGAGG + Intergenic
1161141470 19:2650737-2650759 TGTCCCCCAGCGACCTTCAGCGG + Intronic
1161291538 19:3496311-3496333 TGTGCCCAGACAACCTCAACTGG - Intronic
1161383376 19:3978083-3978105 AGTCCCCCAACAAGCACAACCGG - Exonic
1161957380 19:7504121-7504143 GGGGCCCCAACACCCTCAAGTGG + Exonic
1167603915 19:50469977-50469999 TTTCCCCCGACAACCTTATGGGG + Intronic
1168672557 19:58251911-58251933 TGTCTCCCAAATAACTCAAGGGG - Intronic
925038821 2:714451-714473 TGCCCCGGCACAACCTCAAGGGG + Intergenic
926138764 2:10356117-10356139 AGTCCAGCAACAACCTTAAGAGG + Intronic
927220893 2:20708012-20708034 TGTCCCCCATCACCCTCAGATGG + Intronic
927257010 2:21048444-21048466 TGTGCCCCAGCATCCTCAGGAGG - Intergenic
929592763 2:43157848-43157870 TGTCCCCCCACAACCTGAGGGGG + Intergenic
934178364 2:89597577-89597599 TGTCCCCAAAAGACCTCAGGGGG - Intergenic
934288657 2:91671869-91671891 TGTCCCCAAAAGACCTCAGGGGG - Intergenic
936674778 2:114702367-114702389 GCTCTCCCAACAACATCAAGTGG - Intronic
937281367 2:120719647-120719669 TGTATCCCACCAACCTCCAGAGG + Intergenic
940855254 2:158724358-158724380 TCTCCACCACCAACCTCAAGAGG + Intergenic
942061698 2:172233932-172233954 TGTCCAACAACAACCTAAAAAGG - Intergenic
944828634 2:203510363-203510385 TTACCCTCAAGAACCTCAAGAGG - Intronic
946441680 2:219702223-219702245 TATCCCCCAAGAAAATCAAGGGG - Intergenic
947287540 2:228533192-228533214 TGACCCCCAACAACATGCAGTGG + Intergenic
1173258560 20:41412876-41412898 CGTCCCCCAACCACCGCAAATGG + Intronic
1173258569 20:41412924-41412946 GGTCCCCCAACCACCACAAATGG + Intronic
1176998339 21:15581524-15581546 TGTTCCCCATCATCCTGAAGAGG + Intergenic
1181726362 22:24813817-24813839 TCTCCCCCAGCCACCTCATGAGG + Intronic
1183100757 22:35582636-35582658 TGGCCTCCACCAGCCTCAAGAGG - Intergenic
1183381401 22:37492205-37492227 TGTCAGCCAAACACCTCAAGGGG + Intronic
1184589916 22:45475305-45475327 AGTCCTCCAACAACCTTGAGAGG - Intergenic
949495608 3:4628860-4628882 TGAGCCCCAAGCACCTCAAGAGG + Intronic
950117787 3:10462555-10462577 TATCCCTCAACAACCCCATGAGG + Intronic
953578277 3:44130409-44130431 TGTCCCCTAACAACCTGCTGTGG - Intergenic
958511001 3:95048714-95048736 TGTCCTCCAAAAAGGTCAAGTGG + Intergenic
961266309 3:125645744-125645766 TGTCCCCAGACTACCTCTAGAGG - Intergenic
962652103 3:137506809-137506831 TACCTCCCAATAACCTCAAGTGG + Intergenic
962825787 3:139100190-139100212 AGGCCCCCAGCAACCTCAAAAGG - Intronic
969346452 4:6573631-6573653 TGGCCCCTAACAACCTCCTGTGG - Intergenic
973856148 4:55011954-55011976 TTTCACCCAACAAAGTCAAGTGG - Intergenic
974112316 4:57539422-57539444 TGTTCCCCATCAAGCTAAAGTGG + Intergenic
975392215 4:73833504-73833526 TTCCCCCAAACAACCTCATGGGG - Intergenic
975997828 4:80336570-80336592 TGTCCCCCACCACCCTGCAGCGG - Intronic
976750832 4:88450079-88450101 TGTCTCCCAAATAACTCAAGGGG + Intergenic
986629533 5:9756485-9756507 TGTACCTCTACAAACTCAAGAGG + Intergenic
988924473 5:35975616-35975638 TGTTCCCCACCATCCTAAAGTGG + Intronic
989496271 5:42114038-42114060 TGTGACCCAACTCCCTCAAGGGG + Intergenic
990249129 5:53894819-53894841 TGTCCTCCTATCACCTCAAGGGG + Intronic
990521463 5:56585523-56585545 TGACCTCCAACAACCAGAAGGGG + Intronic
993708393 5:91197097-91197119 TGGCCACCAACAAGCTAAAGAGG + Intergenic
999039985 5:148398155-148398177 TGTTTCACAACAACCTTAAGAGG - Intronic
1001072303 5:168597464-168597486 TGTCCCACAGCAGCCTCAAAAGG - Intergenic
1001859671 5:175042987-175043009 TGTCCCCCATCAACTCCAGGAGG + Intergenic
1002636076 5:180609509-180609531 AGTCCCCCAACATCTCCAAGTGG + Intronic
1004327587 6:14689785-14689807 AATCTCCCAACAACCTTAAGAGG - Intergenic
1013459963 6:110365426-110365448 TCTCCCCCCAGAACCTCACGGGG + Intergenic
1015425407 6:133059982-133060004 TCACCACCAACAACCACAAGTGG + Intergenic
1015940094 6:138441073-138441095 TGTCCTCAAACAACCCTAAGAGG + Intronic
1018243454 6:161800658-161800680 GGTCCCCCAACAGCCTCACGGGG - Intronic
1018450867 6:163906158-163906180 TGTCCCTTAACAAGCACAAGAGG + Intergenic
1021081369 7:16369772-16369794 TTTCCCCCAAGAACCACAATAGG + Intronic
1021610985 7:22457923-22457945 TGTCCCCAAAAAACCCCAACAGG + Intronic
1027516788 7:79151975-79151997 TGTCTCCCATCATCCTGAAGTGG - Intronic
1030939528 7:115629187-115629209 TGTCCCCCATCACTCCCAAGTGG + Intergenic
1033411170 7:141119151-141119173 TGTCCCCCAGCAGTCTCCAGTGG - Intronic
1035593128 8:833404-833426 GGTCCCCCCAGAACCTCAAGAGG - Intergenic
1039991504 8:42491961-42491983 TGTCCCCCAACAATCTCACTGGG + Intronic
1040552914 8:48452558-48452580 TGTCCACCAACACCATCAACAGG + Intergenic
1044572931 8:93740264-93740286 TTTCTCCCAACATCCTCAAACGG + Intronic
1045826496 8:106404107-106404129 TGTCCCCCAACAACCTCAAGTGG - Intronic
1047611516 8:126525750-126525772 TGTGCAACATCAACCTCAAGTGG + Intergenic
1049257487 8:141621621-141621643 TTCTCCCCAACAACCTCAAAAGG - Intergenic
1049613548 8:143566929-143566951 GGTCCCCCAGCAGACTCAAGAGG + Exonic
1050432109 9:5572594-5572616 TTTCCCCCAACCCCCTCAACAGG - Intergenic
1052488257 9:29130354-29130376 TGTCTCCCAAATAACTCAAGGGG + Intergenic
1052565547 9:30145350-30145372 TGTCTCCCATCACCCTCAGGTGG + Intergenic
1053296936 9:36922037-36922059 TGTCCCCCATCCACCTGAGGTGG - Intronic
1055430058 9:76234161-76234183 TGTCCCCTACCGACCTCATGTGG + Intronic
1058280893 9:103113123-103113145 TGTCCTTCAACAACCTCCAGAGG + Intergenic
1058287152 9:103192368-103192390 TGTCTCCCATCACCCTCAGGTGG + Intergenic
1061379503 9:130245611-130245633 TCTGCCCCACCAACCCCAAGGGG + Intergenic
1061475457 9:130862896-130862918 TGTCCCCCAACTACGACAAGTGG + Exonic
1061611611 9:131750301-131750323 TCTCTCCCACCAACCTCACGAGG + Intergenic
1061619594 9:131803194-131803216 TATCCCCCAACAGCCCCAGGAGG - Intergenic
1061681586 9:132245143-132245165 TGTCCCCGAACACCCTCGAGGGG + Intergenic
1061766695 9:132886058-132886080 TTTCCCCAAACAATCTGAAGTGG - Intronic
1189619865 X:42824700-42824722 TCTTCCCCAACTACCTCAAACGG + Intergenic
1192004247 X:67192360-67192382 TCTCACCCAGAAACCTCAAGGGG - Intergenic
1192040535 X:67616346-67616368 TGTCCCCTAACCCCCTCAACAGG + Intronic
1195588989 X:106602130-106602152 CATCCCCCAAGAACTTCAAGGGG - Intergenic
1199144291 X:144347714-144347736 TGTTCCCCATCATCCTTAAGCGG - Intergenic
1199817465 X:151411488-151411510 TTTCCCCTGACAACCTAAAGCGG + Intergenic