ID: 1045826506

View in Genome Browser
Species Human (GRCh38)
Location 8:106404152-106404174
Sequence GATGCTGCTACCACTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045826496_1045826506 22 Left 1045826496 8:106404107-106404129 CCACTTGAGGTTGTTGGGGGACA 0: 1
1: 0
2: 3
3: 13
4: 144
Right 1045826506 8:106404152-106404174 GATGCTGCTACCACTGGGTGTGG No data
1045826490_1045826506 29 Left 1045826490 8:106404100-106404122 CCCTCTACCACTTGAGGTTGTTG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1045826506 8:106404152-106404174 GATGCTGCTACCACTGGGTGTGG No data
1045826491_1045826506 28 Left 1045826491 8:106404101-106404123 CCTCTACCACTTGAGGTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1045826506 8:106404152-106404174 GATGCTGCTACCACTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045826506 Original CRISPR GATGCTGCTACCACTGGGTG TGG Intronic
No off target data available for this crispr