ID: 1045829409

View in Genome Browser
Species Human (GRCh38)
Location 8:106440507-106440529
Sequence TCTATCACCCAGAACTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045829409_1045829411 29 Left 1045829409 8:106440507-106440529 CCTTTCTAGTTCTGGGTGATAGA 0: 1
1: 0
2: 0
3: 15
4: 129
Right 1045829411 8:106440559-106440581 TTAAACCTTACTATAGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045829409 Original CRISPR TCTATCACCCAGAACTAGAA AGG (reversed) Intronic
901564785 1:10104576-10104598 TCTATCCTCCAGAAATACAAAGG - Intronic
901969605 1:12896922-12896944 TCTCACACTCAGAACTACAAAGG - Intronic
902015568 1:13304858-13304880 TCTCACACTCAGAACTACAAAGG + Intronic
902743665 1:18458430-18458452 TCTATCACCTAGAGCTAAGAGGG + Intergenic
904384433 1:30132196-30132218 TCTGTCCTCCAGGACTAGAAGGG - Intergenic
906336016 1:44931768-44931790 CCAATAAACCAGAACTAGAAAGG + Intronic
907053558 1:51345246-51345268 ACTCCCACCCAGAACCAGAAAGG + Intergenic
907396664 1:54195476-54195498 TCTATCACCGAGATCTGGCAAGG - Exonic
908292427 1:62681583-62681605 TCTATGACCCAGAAATTGCAAGG + Intronic
909181612 1:72431041-72431063 ACTATCACCCAGAAGTAAAAAGG + Intergenic
909393172 1:75137352-75137374 ACCTTCACCCAGAACTTGAACGG - Intronic
909968777 1:81953690-81953712 TCTATCACACAGAACCACTATGG - Intronic
910777171 1:90888746-90888768 TATATCAACCAGAACTTTAAAGG + Intergenic
910828221 1:91431797-91431819 TCTACCTCCCAGAATTAGAGAGG + Intergenic
914978307 1:152387802-152387824 TCTATCTCCCAGACTTAGAAAGG + Intergenic
919343170 1:196339807-196339829 TCTATGACACAGAAGAAGAAAGG - Intronic
923235327 1:232027362-232027384 TCTATCACCGGGAAGCAGAAAGG - Intronic
1067307017 10:45073330-45073352 TCTATGACCAAGATCTACAAGGG - Intergenic
1071976073 10:90956627-90956649 TCTGGCACCCAGAACTGTAAGGG + Intergenic
1072008229 10:91277541-91277563 GCTATCATACAGAACTAGAGAGG - Intronic
1073365945 10:102941021-102941043 TGTATCACCCAGATACAGAATGG - Intronic
1075078942 10:119369972-119369994 TCTATCACCAAGGACAAAAAAGG - Intronic
1075565438 10:123500251-123500273 TCAATTACCCAGAACTGGACTGG + Intergenic
1075835551 10:125449804-125449826 TTCATCACCCAGCACGAGAAGGG + Intergenic
1077617959 11:3692280-3692302 TCTGTCACCCAAAACTTGAGTGG - Intronic
1077717111 11:4592667-4592689 GCTATCACACAGGAATAGAATGG + Intergenic
1078252606 11:9628984-9629006 TCCATGAACCAGAAATAGAATGG - Intergenic
1078319177 11:10318493-10318515 TCAAACAGCCAGAAATAGAAGGG + Intronic
1081537544 11:44006338-44006360 GCTAGCACCCAGAGCTGGAAGGG - Intergenic
1087091870 11:94281881-94281903 TTTATGAACCAGATCTAGAAGGG + Intergenic
1087222761 11:95564309-95564331 ACTATCATCCAGAATTGGAAAGG + Intergenic
1087854168 11:103071142-103071164 TCTAGAACCCAGAAAAAGAAAGG + Intronic
1088315459 11:108501976-108501998 TCTGTCACCCATATCTACAATGG + Intergenic
1088813078 11:113404594-113404616 TCCATCTCCCAGCACAAGAAGGG - Intergenic
1090502913 11:127279292-127279314 TCTGCCACCCAGAACCAGAAGGG - Intergenic
1090739826 11:129648689-129648711 TCAATCAACCAGAAATAGAGAGG + Intergenic
1092601951 12:10076653-10076675 TCTAAAACACAGAACAAGAATGG + Intronic
1098736935 12:74117024-74117046 TCTATTACCCAGAAAAAGATGGG - Intergenic
1099370997 12:81829687-81829709 CCTATGACCCACAATTAGAAAGG - Intergenic
1103492158 12:121329975-121329997 CCTATCACTCAAAACGAGAAAGG + Intronic
1103636226 12:122308171-122308193 TCTGTCACTCAGAACCAGAAGGG - Intronic
1107215167 13:37908408-37908430 TCTGACCCCCAGAACTATAAGGG + Intergenic
1107416697 13:40207699-40207721 TCTATTAACCAGAGCTTGAATGG - Intergenic
1107711397 13:43153707-43153729 TATTTCACCCAGGACTAGAGTGG + Intergenic
1109488988 13:63069765-63069787 TAAATAACCCAGAACTAGATAGG + Intergenic
1112526798 13:100156701-100156723 TCTATCAAACTGAACTAAAATGG - Intronic
1114793337 14:25683622-25683644 TCAATCACTGAGCACTAGAAGGG + Intergenic
1119456320 14:74758813-74758835 ACTAGCACCCAGATCAAGAAAGG - Intergenic
1121094282 14:91205067-91205089 TCTATCTCCCAGTCCTAGAATGG - Intronic
1123156214 14:106228999-106229021 TCTGTCATCCTGAACTGGAAAGG + Intergenic
1126076401 15:44914701-44914723 TCTATCCCCCAGTACCAAAAGGG + Intergenic
1127745998 15:61973735-61973757 TCTACCACCCACATCTACAAGGG + Intronic
1128630929 15:69266364-69266386 TCTGTCACCCAGAACAAGAGTGG + Intronic
1130505266 15:84534549-84534571 CCTCTCACTGAGAACTAGAAAGG + Intergenic
1142811205 17:2396445-2396467 TCTCTCACCCAGAACCAGGCAGG - Intronic
1147666868 17:42154637-42154659 CCTCTCTCCCACAACTAGAATGG + Intronic
1151495941 17:74458143-74458165 TCTATCTCCCTGAAGTGGAATGG + Intergenic
1159077833 18:63701461-63701483 CCAATCACACAGAACTAAAAGGG - Intronic
1160588944 18:79929147-79929169 TTTATCAAACAGAACCAGAAAGG + Intronic
1165043423 19:33085164-33085186 TCTATACCCCAGCTCTAGAAGGG + Intronic
1165805320 19:38577195-38577217 TCAATAAGCCAGAAATAGAAAGG - Intronic
1166241015 19:41493847-41493869 TCTATACCCCAGAAAGAGAATGG - Intergenic
1166632413 19:44418675-44418697 TCTATTACTCAGACCAAGAATGG - Intronic
1167412305 19:49351944-49351966 TCTGTCACCCAGGAGTATAATGG - Intronic
926881897 2:17554581-17554603 TCTAACAACCAGAACTAAAGAGG + Intronic
929654886 2:43720907-43720929 TCTATCACCTACACCTACAAGGG + Intronic
930062321 2:47300499-47300521 TCCTTCACCCAGAACTTGAGTGG + Intergenic
930062330 2:47300541-47300563 TCCTTCACCCAGAACTTGAGTGG + Intergenic
930965209 2:57314847-57314869 TCCATCACCCAGGAGTAGAATGG + Intergenic
931457752 2:62425453-62425475 TTTCTCTCCCAGAAGTAGAAGGG + Intergenic
936597198 2:113859508-113859530 TGTAGCAACCAGAACTAAAAGGG + Intergenic
940115668 2:150205563-150205585 GCTATTACCCAAAACTAGAGGGG + Intergenic
941157686 2:161999413-161999435 TCTATCACCAACTACTAAAAAGG + Intronic
941766430 2:169302024-169302046 TCTATTTCTCAGAAATAGAATGG - Intronic
943944517 2:194042780-194042802 TCTCTTACCAAGAACTGGAATGG - Intergenic
944919805 2:204400939-204400961 TCTATCACCAAGAAAGAGATAGG - Intergenic
944964876 2:204919579-204919601 AATATCACCCAGCATTAGAAAGG - Intronic
946689130 2:222297804-222297826 TGTAACACCCAGAGCAAGAATGG - Intronic
1170153754 20:13251164-13251186 TCTTTCACCCAGTAGTTGAATGG + Intronic
1172281816 20:33713177-33713199 TCTATGACCCAAAGCTGGAAAGG + Intronic
1175784787 20:61705621-61705643 GCTCCCACCCAGAACTACAAGGG - Intronic
1178696250 21:34795170-34795192 TCTATCAGCCTGAACTCAAAAGG - Intronic
1179297010 21:40072094-40072116 TCTAAGACTCAGAACTATAAAGG - Intronic
1179445660 21:41428458-41428480 TCCACCACCCAGCACTAGAGCGG - Intronic
1180517513 22:16160779-16160801 TAAATAACTCAGAACTAGAAAGG + Intergenic
950239332 3:11353938-11353960 TCTGTCACCCAGAAGAAGCAGGG - Intronic
951407774 3:22322419-22322441 TCTATCTCCCAGTACTATAAAGG + Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956818208 3:72928367-72928389 TTTATCACACTGAACTGGAAGGG - Intronic
960814890 3:121662330-121662352 TGTATCACACAGAAAAAGAATGG + Intergenic
964806130 3:160611625-160611647 CCCATCACCCAGAAGTGGAAAGG + Intergenic
965506901 3:169526136-169526158 TCCATCACCGAGAATTAGATTGG + Intronic
966203860 3:177385990-177386012 TCTATGACTCAGAACTAAAAGGG - Intergenic
967354840 3:188557094-188557116 TCTAGGTCCCAGAAATAGAAAGG - Intronic
969870919 4:10104154-10104176 TCTATCACCCAGAGATAGGTAGG - Intronic
972172282 4:36361460-36361482 TCTAACAGCCAGAAATAGCAAGG + Intergenic
972672275 4:41225161-41225183 TCTAGCATCCAGAACTGCAAGGG + Intergenic
974121308 4:57642279-57642301 TGAATTACCCAGAAGTAGAATGG - Intergenic
975561971 4:75716828-75716850 TATACCACCCACAACTAGTATGG + Intronic
975878419 4:78871438-78871460 TCTATCAACCAAAACCAGGAGGG - Intronic
978155418 4:105484679-105484701 CCTATAAGCCAGAACGAGAAAGG + Intergenic
978247540 4:106592641-106592663 TATTTCACCCAGAAATAGAAGGG + Intergenic
978880492 4:113696372-113696394 TATATCACCAGGACCTAGAATGG + Intronic
979926241 4:126568287-126568309 TATATCCCACTGAACTAGAAAGG + Intergenic
980192232 4:129539782-129539804 TCTAACATCCAAAACTAGAGAGG - Intergenic
980561726 4:134486184-134486206 TATATAGCACAGAACTAGAAGGG - Intergenic
984548860 4:181137498-181137520 TATATCACCTTGAACTATAAAGG + Intergenic
986755700 5:10834028-10834050 TCTATCCACCAGAGCTAGAAAGG + Intergenic
986824642 5:11507430-11507452 TCCATCACCCAGAGGCAGAAAGG + Intronic
988469107 5:31520723-31520745 GCTATCACCCAAAACTTAAAGGG - Intronic
988885429 5:35552354-35552376 TCTATGAGACAGAACTAGAGAGG - Intergenic
990068094 5:51743666-51743688 TCTAGGACTCATAACTAGAAAGG - Intergenic
997213473 5:132091931-132091953 AGTATCACCAAGAACTAAAATGG - Intergenic
1001215380 5:169851289-169851311 TCTGTCACCCAGAGCTAGTAAGG - Intronic
1007445873 6:41905494-41905516 CCTGTCAGCCAAAACTAGAAGGG + Exonic
1007481339 6:42152216-42152238 TCTTTCACCCAGGTCTGGAAAGG + Intergenic
1009548358 6:65052195-65052217 TCTTTCCCCCAGAACTAAATGGG - Intronic
1010059135 6:71602304-71602326 TATGTCACTCAGAACTATAATGG - Intergenic
1010748864 6:79595645-79595667 TCAATCAACTAGAAGTAGAAGGG + Intergenic
1011888834 6:92131288-92131310 TCTATCACACAAAAACAGAATGG + Intergenic
1014497568 6:122144913-122144935 TATATCAGACAGAAGTAGAAGGG - Intergenic
1016624932 6:146155950-146155972 TCAATCACTGAGAACAAGAATGG + Intronic
1018069326 6:160148159-160148181 TCTATCAGCCATTTCTAGAAGGG - Intronic
1025758410 7:64367743-64367765 TCTATCACTCAAAATGAGAAAGG + Intergenic
1027234430 7:76289647-76289669 TCTTTTCCCCAAAACTAGAAGGG + Intergenic
1029120162 7:98262442-98262464 TCTGTCACCCAGGCCAAGAAGGG - Intronic
1037405143 8:18534394-18534416 TTTATCACCCTGAACTTCAAAGG + Exonic
1041189479 8:55338993-55339015 TCTAGAAACCAGAACTATAAAGG + Intronic
1041472651 8:58228366-58228388 TGTAAGACCCAGAAATAGAAAGG + Intergenic
1045829409 8:106440507-106440529 TCTATCACCCAGAACTAGAAAGG - Intronic
1047434615 8:124825838-124825860 TCTAGCCTCCAGGACTAGAAGGG - Intergenic
1048848327 8:138620552-138620574 TCTATCACAAAGACCTACAAGGG - Intronic
1051349923 9:16189404-16189426 TCTCTGACCCAGAGCTAGAAAGG + Intergenic
1055703549 9:78972853-78972875 TCTTTTACCAAGAGCTAGAAGGG - Intergenic
1057618524 9:96615728-96615750 TATAACACCCAGGAGTAGAATGG - Intronic
1057785447 9:98084039-98084061 CCTAGCACCCAGACCCAGAAGGG - Intronic
1187140601 X:16589627-16589649 TCTGTCAACCAGAACCAGAGGGG - Exonic
1188310437 X:28610582-28610604 TCTTTCATCTAGAACTATAAGGG - Intronic
1193542276 X:82787232-82787254 TCAATCAGACAGAAGTAGAAAGG - Intergenic
1196365474 X:114918777-114918799 TCTTTCTCCCAGAAAGAGAAGGG - Intergenic
1196806694 X:119594307-119594329 TCTGTCACCCAGACCTAGACTGG - Intronic
1197337902 X:125230949-125230971 TTTATGACCCAGAATTAGAAAGG - Intergenic
1199804908 X:151289266-151289288 TCTCTCACGCAGGAGTAGAAAGG - Intergenic
1202364683 Y:24150074-24150096 CCTCTCACTGAGAACTAGAAAGG - Intergenic
1202506098 Y:25520048-25520070 CCTCTCACTGAGAACTAGAAAGG + Intergenic