ID: 1045829806

View in Genome Browser
Species Human (GRCh38)
Location 8:106445433-106445455
Sequence ATGAGCAGTTCTCAAACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045829806_1045829809 0 Left 1045829806 8:106445433-106445455 CCTGCAGTTTGAGAACTGCTCAT 0: 1
1: 0
2: 1
3: 32
4: 274
Right 1045829809 8:106445456-106445478 TATTAACTGGGTCATGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045829806 Original CRISPR ATGAGCAGTTCTCAAACTGC AGG (reversed) Intronic
901988674 1:13094984-13095006 CCCAGCAGGTCTCAAACTGCTGG - Intergenic
901993139 1:13131783-13131805 CCCAGCAGGTCTCAAACTGCTGG + Intergenic
904152617 1:28454908-28454930 CTGAGCTGGTCTCAAACTGCTGG - Intronic
904948578 1:34217294-34217316 ATCAGAAGTTCTCAACCTGGAGG + Intronic
905039560 1:34944309-34944331 CTGGGCTGTTCTCAAACTCCTGG - Intergenic
906268445 1:44454132-44454154 ATCAGCAGATCTCAAAGTGTAGG - Intronic
906370637 1:45250451-45250473 ATGATCATATCTCAAACTCCTGG - Intronic
907260496 1:53214658-53214680 ATCAGCACTTCACAAACTGGTGG + Exonic
907293743 1:53435412-53435434 ATGAGTAGTTCTCAAAGAGGTGG + Intergenic
908205935 1:61849383-61849405 CTCAGCAGATCTCAAACTTCTGG - Intronic
908637096 1:66179437-66179459 ATGAGTAGTTCTCACTCTCCTGG - Intronic
908675777 1:66601858-66601880 ATTAGTATTTTTCAAACTGCAGG - Intronic
908719544 1:67109606-67109628 ATGAGCATGAATCAAACTGCTGG + Intronic
909138167 1:71828797-71828819 AGGAGCAGAGCTCACACTGCAGG - Intronic
912862422 1:113225876-113225898 ATGAGCAGATCTTAAACTATGGG - Intergenic
913050588 1:115113773-115113795 ATTAGCTGTTCTCAAACCTCAGG + Intergenic
913158867 1:116127755-116127777 ATCAGCAGTTCTCAAAGTGTGGG + Intronic
914782200 1:150795653-150795675 ACAAGCTGGTCTCAAACTGCTGG + Intergenic
915899438 1:159835735-159835757 AGCATCAGATCTCAAACTGCAGG - Exonic
917485429 1:175450874-175450896 ATGAGCAGTTAACAATCTGTGGG - Intronic
918014762 1:180622740-180622762 ATCAGCAGTTGCCAAACTGCTGG + Intergenic
922207377 1:223460182-223460204 ACGGGCTGTTCTCAAACTCCTGG - Intergenic
923632530 1:235660982-235661004 ATGAGCAGATCTCAAATCGATGG - Intergenic
924194700 1:241593672-241593694 ATGAGCAAATCTCAAAGAGCTGG + Exonic
1063686321 10:8240261-8240283 CTGAGCTGGTCTCAAACTCCTGG + Intergenic
1064489809 10:15842288-15842310 ATTAACAGTTCTTTAACTGCAGG + Intronic
1067008060 10:42683397-42683419 ATGAGGAGTTCTCAGAGAGCGGG - Intergenic
1072091259 10:92129830-92129852 CTGGGCTGTTCTCAAACTCCTGG - Intronic
1075944084 10:126417562-126417584 ATGAGCAGTCATTCAACTGCTGG - Intergenic
1076208345 10:128621389-128621411 ATTAGCAGTTATCGAATTGCAGG - Intergenic
1076331410 10:129672953-129672975 ATGAGCTGATCCCACACTGCCGG - Intronic
1076504232 10:130961418-130961440 ATGATCATTTCTCAAAATCCAGG + Intergenic
1079669174 11:23144763-23144785 ATGAGCATTTCTCAGACTCAGGG + Intergenic
1081646468 11:44793797-44793819 ATGGGCAGTTGTCAAATGGCTGG - Intronic
1083046654 11:59742537-59742559 ATCAGCATTTCTTAAAATGCTGG + Intronic
1084319282 11:68364561-68364583 ATCAGCAGTTCTCAGCCTGGGGG + Intronic
1084616182 11:70237462-70237484 ATCAGCAGTTCTGAAGCTGATGG + Intergenic
1084944888 11:72633107-72633129 AGCAGCAGTTCTCTAACTGGCGG - Intronic
1085161605 11:74352835-74352857 ATGGACAGTTCTCAAACCCCAGG - Intronic
1086575862 11:88338262-88338284 AAGATAAGTTCTCAAACAGCTGG - Intergenic
1086844593 11:91732547-91732569 TTTAGCAGTTCTTATACTGCTGG - Intergenic
1089057197 11:115595303-115595325 GACAGCAGTTCTCAAAGTGCTGG - Intergenic
1089476662 11:118769080-118769102 CTAAGCTGTTCTCAAACTCCTGG - Intronic
1089512351 11:119007694-119007716 CTGAGCTGGTCTCAAACTCCTGG + Intronic
1090301163 11:125640836-125640858 CCCAGCTGTTCTCAAACTGCTGG + Intronic
1090339157 11:126000415-126000437 TCAAGCAGTTCTCAAACTCCTGG + Intronic
1091116013 11:133014243-133014265 ATGAGCAGTTCTCCAAGAGGTGG - Intronic
1093167557 12:15822455-15822477 ATGAGCATTTCTCCAAATGTGGG + Intronic
1093869672 12:24273497-24273519 ATGTGCAGATATCAAACAGCTGG - Intergenic
1094341194 12:29413069-29413091 CTGAGCTGGTCTCAAACTCCTGG + Intronic
1095150006 12:38782887-38782909 CTAAGCTGTTCTCAAACTACTGG + Intronic
1095559588 12:43550712-43550734 ATGAGCAGGTCTCTGCCTGCTGG - Intronic
1095669138 12:44837419-44837441 ATCAGTGGTTCTCAACCTGCCGG - Intronic
1095812785 12:46388217-46388239 ATTAGCAATTCTCAAACTTTTGG + Intergenic
1098626599 12:72678603-72678625 ATAAGAAGTTCTCACATTGCAGG - Intergenic
1100486924 12:95038546-95038568 CCAGGCAGTTCTCAAACTGCTGG - Intronic
1100799831 12:98219465-98219487 ATGAGTAGTTCTCAAAGAGGTGG - Intergenic
1102564395 12:113785872-113785894 AACAGCAGTTCTCAAACTTTTGG - Intergenic
1102642236 12:114377253-114377275 ATGATCATTTTTCAAACTGAAGG - Intronic
1103398759 12:120627888-120627910 CTGAGCTGATCTCAAACTCCGGG + Intergenic
1107188601 13:37551963-37551985 AAGAACAGTTTTCAAAATGCTGG + Intergenic
1111026485 13:82533948-82533970 TTTAGCAGTTCTTATACTGCAGG - Intergenic
1111664175 13:91246133-91246155 ATGAGCTGGTCTCAAACTCCTGG + Intergenic
1112417562 13:99216579-99216601 GAGGGCATTTCTCAAACTGCAGG - Intronic
1113374408 13:109750837-109750859 AGCAGTAGTTCTCAAACTTCAGG - Intergenic
1114625442 14:24126172-24126194 ACAAGCTGTTCTCAAACTCCTGG + Intronic
1116340826 14:43721810-43721832 ATGAGTAGTTCTCACTCTGTTGG - Intergenic
1118386749 14:65262046-65262068 CTGGGCTGTTCTCAAACTCCTGG + Intergenic
1119440966 14:74628475-74628497 TTGACCAGTTCTGAAACTCCTGG - Intergenic
1121709251 14:96025204-96025226 ACGAGGATTTCTCTAACTGCAGG - Intergenic
1122513915 14:102292629-102292651 ATGAGCAGTTCTGTAACAGGAGG - Intronic
1122604624 14:102939927-102939949 AGGAGCGGTTCTCAACGTGCCGG - Exonic
1122611229 14:102984824-102984846 CTGAGCAGTTCTCACACCACTGG - Intronic
1124196347 15:27633724-27633746 GTTAGCAGTTCTCAAAATCCTGG + Intergenic
1124204510 15:27705355-27705377 ATGAGCAATTCTCAAAGAGTGGG + Intergenic
1125686985 15:41569240-41569262 CAGAGCTGGTCTCAAACTGCCGG - Intronic
1126698268 15:51343777-51343799 GGGAGCAGTTCTCAAACAGTAGG + Intronic
1128546582 15:68572706-68572728 ATCAGCAGTTCTCAAAGTGTGGG - Intergenic
1129146454 15:73652332-73652354 ATGGGCTGGTCTCAAACTCCTGG - Intergenic
1129748502 15:78042562-78042584 ATCAGTGGTTCTCAAGCTGCAGG + Intronic
1130557429 15:84932504-84932526 AGAAGGAGTTCTCAAACTGCAGG + Intronic
1131169476 15:90167085-90167107 CTAGGCTGTTCTCAAACTGCTGG + Intronic
1131877287 15:96822513-96822535 CTCAGCAGTTCTCAAACTTTTGG + Intergenic
1131877295 15:96823167-96823189 CTCAGCAGTTCTCAAACTTTTGG - Intergenic
1133544681 16:6794336-6794358 ATGAGGCATTCTCAAACTACAGG + Intronic
1134133730 16:11666754-11666776 CTGAGCTGGTCTCAAACTCCTGG - Intergenic
1134306959 16:13041717-13041739 GCCAGCAGTTCTCAAACTGTAGG + Intronic
1135615429 16:23907473-23907495 ATAGGCTGGTCTCAAACTGCTGG + Intronic
1137968146 16:52957185-52957207 CTGGGCAGGTCTCAAACTCCTGG - Intergenic
1138021223 16:53483349-53483371 CTGAGCCGTTCTCCAACTCCTGG - Intronic
1138313749 16:56050549-56050571 ATCAGCAGTTCTCAACCTTTTGG - Intergenic
1139292030 16:65867850-65867872 AGCAGTAGTTCTCAAACTTCAGG - Intergenic
1140820627 16:78659503-78659525 ATCAGAAGTTCTCAAACTTTAGG - Intronic
1141055088 16:80806223-80806245 ATAAGCAGTTCTCTATCTGTAGG + Intergenic
1141491937 16:84379650-84379672 AGCAGCAGTACTCAAACTCCAGG - Intronic
1143993200 17:10984646-10984668 CTAAGCAGTTCACCAACTGCAGG - Intergenic
1144220343 17:13094174-13094196 ATGAGTAGTTCTCAAAGAGGTGG - Intergenic
1144349664 17:14382900-14382922 CTAGGCAGTTCTCAAACTCCTGG + Intergenic
1146066421 17:29639370-29639392 ATGAGGAGTTACCAAACCGCAGG + Intronic
1146119640 17:30180780-30180802 ATCAGGAGTTGGCAAACTGCAGG - Intronic
1146961231 17:36981745-36981767 ATAGGCAGGTCTCAAACTCCTGG + Intronic
1147404142 17:40198911-40198933 CTGAGCTGGTCTCAAACTCCTGG - Intergenic
1148262658 17:46196895-46196917 CTGGGCTGTTCTCAAACTCCTGG - Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150637331 17:66922980-66923002 ATGAGTAGTTCTCAAAGAGGTGG + Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1150797497 17:68249854-68249876 CTGAGCTGTTCTCAAACTCCTGG + Intronic
1151413360 17:73945888-73945910 ATGAGCAGTTCTCACACTTGTGG - Intergenic
1151710158 17:75799907-75799929 CTGAGCAGGTCTCAAACTCCTGG - Intronic
1152125135 17:78442150-78442172 ACGAGCAGTTCTCACCCTTCGGG - Intronic
1152615216 17:81334675-81334697 GTGAGCAGTTCCCAAACTCCTGG - Intergenic
1153559578 18:6358500-6358522 ATGCTCTGTTCTAAAACTGCAGG - Intronic
1155278128 18:24210079-24210101 ATTAGCATTTCTCAAACTTTTGG + Intronic
1155358163 18:24973765-24973787 ATGAGTAGTTCTCAAAGTAGTGG - Intergenic
1155441552 18:25867730-25867752 CTGAGCTGGTCTCAAACTCCTGG + Intergenic
1155924609 18:31642078-31642100 AGGAGCAGTTCTCAAACTGGAGG + Intronic
1156369080 18:36456561-36456583 ATGAGCAGTTTGAAAACTACAGG - Intronic
1157146401 18:45167070-45167092 CTGAGCAGTTGTCACAATGCAGG - Intergenic
1157326418 18:46672046-46672068 GTCAGCAGTTCTCAAACTGGAGG - Intronic
1157672351 18:49541081-49541103 ATGAGGAGGTCTCAAAGTGTGGG - Intergenic
1158035084 18:53018782-53018804 ATGAGCATCTCTAAAACTGAAGG - Intronic
1159612736 18:70544740-70544762 TTTAGCAGTTCTCATAGTGCTGG + Intergenic
1162773966 19:12967604-12967626 AAAAGCAGGTCTCAAAATGCTGG - Intronic
1163553619 19:17980295-17980317 CTGGGCTGGTCTCAAACTGCTGG + Intronic
1165498206 19:36166851-36166873 ATGAGTAGTTCTCAAAGAGGTGG - Intergenic
1167221111 19:48198819-48198841 TTGGGCTGTTCTCAAACTCCTGG + Intronic
1167789770 19:51667144-51667166 ATAAGCACTTTTCAAACCGCTGG - Intergenic
924992677 2:327204-327226 TTTATCAGTTCTCATACTGCTGG + Intergenic
925767577 2:7251465-7251487 ATGAGTAGTTTTAAAACTGTTGG + Intergenic
925916165 2:8608031-8608053 TTGAGGAGTTCGCAAACAGCAGG + Intergenic
926933276 2:18062017-18062039 ATGAGTACTTCTGAAAATGCAGG + Intronic
927333544 2:21893863-21893885 CATAGCAGGTCTCAAACTGCTGG - Intergenic
928908306 2:36391654-36391676 AACAGCAGTTCTCAAAGTGTGGG + Intronic
928916157 2:36473293-36473315 ATGAGCCCTGCTCAATCTGCCGG - Intronic
929196001 2:39184942-39184964 ATGAGCTGGTCTCAAACTTCTGG + Intronic
930115293 2:47712872-47712894 TTGGGCAGGTCTCAAACTCCTGG - Intronic
930120839 2:47759402-47759424 ATGAGCAGTTCTCAAAGAGGTGG + Intronic
930545251 2:52759514-52759536 ATGAGCTGTTCTCAAACCTCAGG - Intergenic
931356673 2:61543062-61543084 TTCAGTAGTTCTCAAACTGAGGG + Intergenic
931411510 2:62036839-62036861 ATGAGCAGTAATCAAAAAGCAGG - Intronic
931448052 2:62343567-62343589 ATGAGTAGTTCTCAAAAAGGTGG - Intergenic
932046258 2:68353020-68353042 ATGAGCAGTTCTCAAAGTATGGG + Intergenic
932250200 2:70236835-70236857 CTGAGCTGGTCTCAAACTCCTGG + Intronic
933854810 2:86402901-86402923 GTGAGCTTTTCTCAAACTGGGGG + Intergenic
936805570 2:116327709-116327731 ACAAGCAGTTCTCAGACTGATGG - Intergenic
937522915 2:122733753-122733775 ATGAGTAGTTCTCAAAGAGGTGG + Intergenic
940131520 2:150387985-150388007 GTGAGCAGTTCTCTGGCTGCTGG + Intergenic
940755396 2:157676189-157676211 CTAAGCTGGTCTCAAACTGCTGG - Intergenic
942645303 2:178104131-178104153 ATGATCAGTTATCCAAATGCAGG + Intronic
942709207 2:178813760-178813782 ATGAGCAGTTCTCCTCCTGTTGG + Intronic
943335233 2:186605388-186605410 CTGAGCAATTCTCAAAATGATGG - Intronic
943802845 2:192083947-192083969 AAGAGCATTTTTCAAACTCCTGG - Intronic
944365567 2:198915103-198915125 ATAAGCAGTTCTCAAACTTAGGG - Intergenic
944958672 2:204842966-204842988 ATCTGCAGTTCTCAAACTCCAGG + Intronic
945338049 2:208616390-208616412 TTTAGCAGTTCTTAAAGTGCTGG + Intronic
945562667 2:211357986-211358008 AACAGTAGTTCTCAAACTTCAGG - Intergenic
945699025 2:213148138-213148160 ATGAGCATTTTCCAAAATGCTGG + Intronic
947112418 2:226732991-226733013 ATGTGCAGTCTTCCAACTGCTGG - Exonic
948101405 2:235376689-235376711 CTGGGCTGTTCTCAAACTCCTGG - Intergenic
948373671 2:237506075-237506097 ATCAGCAGTTCTCAAACCTTTGG + Intronic
1169869645 20:10237171-10237193 ATGAGCAGTTTGCCAGCTGCTGG + Intronic
1170491742 20:16884073-16884095 TTGAGCATTTCTCATATTGCTGG + Intergenic
1171259027 20:23714976-23714998 TTTAGCAGTTCTCATAGTGCTGG + Intergenic
1173455411 20:43197515-43197537 ATGAGCTGTTATCAAACAGAAGG + Intergenic
1173647927 20:44645171-44645193 AAGAGGAGGTCTCAAACTCCTGG - Intronic
1173832207 20:46097855-46097877 ATCAGTAGTTCTCAAACTTCAGG - Intergenic
1173999640 20:47365070-47365092 CTGGGCAGATCTCAAACTCCTGG + Intergenic
1174433592 20:50489349-50489371 AAGAGATGCTCTCAAACTGCTGG + Intergenic
1174877900 20:54247595-54247617 ATGAGCAGTGCTCACACTCGAGG - Intergenic
1175721160 20:61288256-61288278 ATGAGGATTTCTCAATCTTCTGG + Intronic
1175968321 20:62671110-62671132 ATGGGCAGTTCTGAACCTTCAGG - Intronic
1177626327 21:23665259-23665281 ATGTGCTGGTCTCAAACTTCTGG + Intergenic
1177631573 21:23735414-23735436 ATGAGGAATTCTTAAAATGCAGG + Intergenic
1177666740 21:24169433-24169455 ATGTGCTGGTCTCAAACTCCTGG - Intergenic
1181435432 22:22907640-22907662 ATGAACTGTTTTCCAACTGCAGG - Intergenic
1182185702 22:28399513-28399535 CTGGGCTGTTCTCAAACTCCTGG + Intronic
1183576749 22:38695654-38695676 ACGGGCTGGTCTCAAACTGCTGG + Intronic
1184876093 22:47276585-47276607 ATGTGCAGTTCTCTGAATGCAGG - Intergenic
951600688 3:24371537-24371559 ATGAGTAATTCTGACACTGCCGG - Intronic
951729309 3:25793201-25793223 AAGAGCTGGTCTCAAACTCCTGG + Intronic
952273496 3:31855229-31855251 CTGAGCTGGTCTCAAACTCCTGG + Intronic
952601676 3:35090540-35090562 ATTAGCAGTTCTCATAGTGCTGG - Intergenic
953276882 3:41509798-41509820 TTTAGCAGTTCTCATAATGCCGG - Intronic
954476739 3:50753570-50753592 ATAAGCTGGTCTCAAACTCCTGG + Intronic
955295979 3:57735280-57735302 ATGAGGTGGTCTCAAACTCCTGG + Intergenic
956928036 3:74010422-74010444 ATGAGTAGTTCTCAAAGAGATGG + Intergenic
957002468 3:74902023-74902045 TTGTGCCGTTCTCAAACTGAGGG + Intergenic
957805016 3:85134900-85134922 ATGAACAGTATTCAAACTACTGG - Intronic
959171733 3:102852425-102852447 AAGAGTAGTTCTCAAACTTTTGG - Intergenic
960519224 3:118636325-118636347 ATGAACAGTTCTAAAAGTTCTGG + Intergenic
963110975 3:141687757-141687779 CTGAGCTGGTCTCAAACTCCTGG + Intergenic
963595589 3:147320266-147320288 ATGAGCTGGTCTCAAACTTCTGG - Intergenic
964321764 3:155505634-155505656 AAGAGCAGTTCAAAAAATGCTGG + Intronic
965398922 3:168194765-168194787 ATGAGCAGGACTGAAACTGGTGG - Intergenic
966175725 3:177136042-177136064 ATCAGGGGTTTTCAAACTGCAGG + Intronic
966287274 3:178312518-178312540 ACGGGCTGTTCTCAAACTCCTGG - Intergenic
967466157 3:189808310-189808332 AGGAGCCGTTCTGAATCTGCTGG - Exonic
969997112 4:11324382-11324404 ATGAGCAGAACACAAGCTGCTGG - Intergenic
970622967 4:17845334-17845356 ATGAGCAGTTGTAAAACAGGTGG - Intronic
971085660 4:23272127-23272149 AGGAGCAGTTATAAAAGTGCAGG - Intergenic
971090220 4:23334494-23334516 AAGAGCAATTCTCCACCTGCAGG - Intergenic
971318363 4:25585775-25585797 CTGAGCTGGTCTCAAACTCCTGG + Intergenic
973692047 4:53445490-53445512 ATGAGTAGTTCTCAAAGAGATGG + Intronic
973810432 4:54564665-54564687 AACTGCAGTTTTCAAACTGCAGG - Intergenic
973941731 4:55917748-55917770 ATGGGCTGGTCTCAAACTTCTGG + Intergenic
975642667 4:76515914-76515936 TTGATCTGTTCTCAAACTCCAGG + Intronic
976330241 4:83823270-83823292 TTGAGGAGTTCTCAAAGTGAAGG - Intergenic
978259964 4:106743831-106743853 ATGAGTAGTTCTCAAAGAGGTGG + Intergenic
978451863 4:108842933-108842955 CCAAGCTGTTCTCAAACTGCTGG - Intronic
978550290 4:109918408-109918430 TTGGGCATTTCTCAAACTCCAGG - Intronic
979568029 4:122179066-122179088 ATAAGCTGGTCTCAAACTCCTGG - Intronic
983037393 4:162884718-162884740 ATGAGTAGTTCTCAAAGAGGTGG + Intergenic
984234462 4:177138873-177138895 TTGAGCAGTTCTTATAGTGCTGG - Intergenic
984262682 4:177461038-177461060 ATGAGCAGTTTTAAAAGTTCTGG + Intergenic
985091542 4:186367757-186367779 ATGAGCACTTCTCCAAGTCCTGG + Intergenic
986196627 5:5542690-5542712 ATGAGCAGTTCTCAAAGATGTGG + Intergenic
986998001 5:13629161-13629183 ATGTGTATTTCTCAAATTGCTGG + Intergenic
988205869 5:28133555-28133577 ATGAGTAGTTCTCAAAGAGGTGG + Intergenic
988770139 5:34425023-34425045 CTGAGCTGGTCTCAAACTCCTGG - Intergenic
990254902 5:53957611-53957633 CTGAGCTGGTCTCAAACTCCTGG - Intronic
990672035 5:58142634-58142656 ATGATCAGTTTTCAAACATCTGG - Intergenic
993726444 5:91372977-91372999 ATGAGTAGTCCTCAAAAGGCAGG - Intronic
995825577 5:116295164-116295186 GTGGGCTGTTCTCAAACTCCTGG - Intronic
996043377 5:118842721-118842743 CTGGGCTGGTCTCAAACTGCTGG - Intronic
997156688 5:131568526-131568548 ACAAGCAGATCTCAAACTCCTGG + Intronic
998299908 5:141007935-141007957 ATGAGCAGTTCTCAAAAAGGTGG - Intronic
1000158886 5:158580329-158580351 TTGAGCAGTTCTTATAGTGCTGG + Intergenic
1000298394 5:159933113-159933135 AAGAGCTGTTATCAAACTTCTGG + Intronic
1000703325 5:164479975-164479997 ATTAGTAGTTCTCATACTGTGGG + Intergenic
1000914088 5:167058853-167058875 ATCTTCAGTTCTCAAACTGTGGG + Intergenic
1003891396 6:10566706-10566728 ATGAGCAGTACTCAAGATGATGG + Intronic
1004449810 6:15734862-15734884 ATCAGCATTTCTTAAACTGGGGG + Intergenic
1004882796 6:20025161-20025183 ATGAGCAGTTCTCAGCCGGTAGG - Intergenic
1007554398 6:42753919-42753941 ATGAGCACTTCCCAAAGTGCTGG + Intronic
1007554407 6:42753979-42754001 ATGAGCACTTCCCAAAGTGCTGG + Intronic
1007554416 6:42754039-42754061 ATGAGCACTTCCCAAAGTGCTGG + Intronic
1007554425 6:42754099-42754121 ATGAGCACTTCCCAAAGTGCTGG + Intronic
1007957076 6:45927784-45927806 ATGAGGAGTTCTCAAAGAGATGG - Intronic
1011437222 6:87351339-87351361 ATGAGCAGTTCAGGGACTGCAGG + Intronic
1011916615 6:92513804-92513826 ATAATGAGTTCTCAAACTGAGGG + Intergenic
1013281885 6:108645577-108645599 ATGAGAACTTCTAAAACTTCAGG + Intronic
1013319123 6:108969512-108969534 ATAAGCACTTTTCACACTGCAGG + Intronic
1015544307 6:134346291-134346313 AAGGGCTGTTCTCAAACTCCTGG - Intergenic
1015846189 6:137523157-137523179 AAGAGCAGTTCTCATTCTACTGG - Intergenic
1015872947 6:137795323-137795345 ATGAGTAGTTCTCAAAGGGGTGG - Intergenic
1017264620 6:152428131-152428153 ATTAGCAGTTCTTAAAGTGATGG - Intronic
1017402111 6:154076566-154076588 ATGACCAGTTCCAAAAGTGCTGG - Intronic
1018596893 6:165490418-165490440 AACAGCAGTTCTCATAGTGCTGG - Intronic
1018788472 6:167127708-167127730 CTGGGCTGTTCTCAAACTCCTGG + Intronic
1019001760 6:168759607-168759629 ATCAGCAATTTTAAAACTGCTGG + Intergenic
1019125084 6:169833075-169833097 CTGAGCAGTTCTTACACGGCAGG - Intergenic
1020203225 7:6096261-6096283 ATAAGCTGGTCTCGAACTGCTGG - Intergenic
1021548617 7:21844602-21844624 ATCAGTGGTTCTCAAACTGGGGG + Intronic
1022495069 7:30847940-30847962 CTGGGCTGTTCTCAAACTCCTGG + Intronic
1023393249 7:39730457-39730479 CTGAACAGGTCTCAAACTCCTGG - Intergenic
1023706440 7:42946325-42946347 ATGAGAAGTCATCAAACTTCTGG - Intronic
1024201048 7:47106046-47106068 GTGAGCAGTGCTCACACAGCTGG + Intergenic
1024264721 7:47597857-47597879 ATTTGCAGTTCTCAGACAGCAGG - Intergenic
1024476695 7:49819637-49819659 ATGAGTAGTTCTCAAAGAGGTGG + Intronic
1024876044 7:54025019-54025041 ATTAGCAGTTCTTATAGTGCTGG + Intergenic
1025803855 7:64810612-64810634 ATTAGAAGTTCACAAACTGTGGG + Intronic
1026172324 7:67964811-67964833 CTGAGCTGGTCTCAAACTCCTGG - Intergenic
1028880357 7:95873038-95873060 ATGAGAATTTCTTAATCTGCTGG + Intronic
1030212763 7:107012532-107012554 AGCAGCAGTTCTCAAAGTGTGGG + Intergenic
1032813805 7:135450561-135450583 ATAGGCTGTTCTCAAACTCCTGG + Intronic
1032853726 7:135816873-135816895 AAGAGCTGGTCTCAAACTTCTGG + Intergenic
1034044469 7:147913214-147913236 AGGAGCATCTCTCATACTGCTGG + Intronic
1035548997 8:505789-505811 ATGAAAAACTCTCAAACTGCAGG + Intronic
1036512116 8:9410185-9410207 CCGGGCTGTTCTCAAACTGCTGG - Intergenic
1038380152 8:27085204-27085226 ACTAGCAGTTCTTAAATTGCTGG - Intergenic
1038549632 8:28455444-28455466 ACGAGCTGGTCTCAAACTCCTGG + Intronic
1038919279 8:32064777-32064799 ACTAGCAGTTCTTATACTGCTGG - Intronic
1039711013 8:40055909-40055931 GTGAGAAGTTCTCAAACTTCTGG + Intergenic
1039812258 8:41059585-41059607 TTGAGCAGTTCTCAAAGTGTGGG + Intergenic
1039851444 8:41368952-41368974 AGGAGCAGTTCTCAAGCTGTTGG + Intergenic
1040072797 8:43202040-43202062 AGAAGCATTTCTCAAACTGTGGG + Exonic
1040442654 8:47460826-47460848 TTTAGCAGTTCTCATAGTGCTGG + Intronic
1040954385 8:52964852-52964874 ATGAGTAGTTCTCCAACAGGTGG - Intergenic
1042029780 8:64463490-64463512 CTCAGCTGTTCTCAAACTCCTGG - Intergenic
1042198127 8:66251834-66251856 ATGAGTAGTTCTCAAAAAGGTGG + Intergenic
1042228597 8:66534907-66534929 CTAAGCTGTTCTCAAACTCCTGG + Intergenic
1042352920 8:67796165-67796187 ATAAGTAGTTCTCAAACTTTAGG + Intergenic
1042442034 8:68839770-68839792 CTGGGCTGTTCTCAAACTCCTGG + Intergenic
1042722333 8:71840189-71840211 ATGAGCAGTGCACTAAATGCTGG - Intronic
1045291313 8:100835111-100835133 ATGAGTAGTTCTCAAAGTGGTGG - Intergenic
1045829806 8:106445433-106445455 ATGAGCAGTTCTCAAACTGCAGG - Intronic
1047488660 8:125355941-125355963 CTCAGCAGTTCTCAAAGTGCAGG + Intronic
1050165371 9:2759777-2759799 ATGAGTAGTTCTCAAAGAGGTGG + Intronic
1050366987 9:4881885-4881907 AAGAGAAGTTCTCATTCTGCTGG - Intronic
1050677158 9:8069285-8069307 TTGAGCTGGTCTCAAACTCCTGG + Intergenic
1050899669 9:10930684-10930706 GTGAGCAGTTCGCAGAATGCTGG - Intergenic
1051024631 9:12593155-12593177 ATGATGTGTTCCCAAACTGCTGG - Intergenic
1051396939 9:16632946-16632968 ATGATCAGTTCTCATGCTTCGGG - Intronic
1051744427 9:20281137-20281159 ACAAGCAGTTCTCGAACTCCTGG + Intergenic
1057283820 9:93731489-93731511 ATCAGCAGCTCTCTAACTGGTGG - Intergenic
1059126692 9:111694873-111694895 ATGAGCAATTCCCAAAATGCTGG - Intronic
1059925477 9:119205124-119205146 ATGAGTATTTCTCACACCGCAGG - Intronic
1061987642 9:134139082-134139104 ACGAGCAGGACTCACACTGCAGG - Intronic
1186263925 X:7811060-7811082 AGAAGCAGCTCTCAAAATGCAGG - Intergenic
1186869629 X:13757738-13757760 ATGAGGAGTTCGAAAGCTGCAGG + Exonic
1187080484 X:15981589-15981611 ATGAGTAGTTCTCAAAGAGGTGG + Intergenic
1194756005 X:97740899-97740921 AAGAGCAGTTCACAGACTCCAGG + Intergenic
1197150801 X:123217948-123217970 ATGAGCAGTTTGCAATCTGTCGG - Intronic
1197840519 X:130741325-130741347 AAGGGCAGTTAGCAAACTGCTGG + Intronic
1198957163 X:142146039-142146061 ATGAGCAGTTGTGGCACTGCAGG - Intergenic
1199645689 X:149908729-149908751 ATGCACAATTCTCAAACTGCAGG - Intergenic
1201268674 Y:12233451-12233473 ATCATCAGTTCTCACTCTGCTGG + Intergenic