ID: 1045831134

View in Genome Browser
Species Human (GRCh38)
Location 8:106461635-106461657
Sequence CAGGCTTAAAATAGTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045831134 Original CRISPR CAGGCTTAAAATAGTTTTAA AGG (reversed) Intronic
902992477 1:20198268-20198290 CAGTCTTAAAATAATTATGAAGG - Intergenic
907624795 1:56019024-56019046 CAGATTTTAAATAATTTTAAAGG + Intergenic
908278842 1:62507104-62507126 CAGCCATAAAATACTTTTAAAGG + Intronic
908590879 1:65631874-65631896 GAGGCTTAAAATATCTTTAAGGG - Intronic
908982650 1:69977310-69977332 CATAATTAAAATATTTTTAATGG - Intronic
909338130 1:74500337-74500359 AAGGCTTAAATAATTTTTAAAGG - Intronic
909735016 1:78947862-78947884 CAGGCTTAATTTCTTTTTAAAGG + Intronic
910387226 1:86698152-86698174 AAGGCTTAAAAATGTTTCAATGG - Intergenic
910393224 1:86765468-86765490 TAGGCTAAATATAATTTTAATGG - Intergenic
910525433 1:88172623-88172645 CAGGCTTAAAATAGCATAAGAGG + Intergenic
910537919 1:88320842-88320864 CACGATGCAAATAGTTTTAAAGG + Intergenic
910569141 1:88681088-88681110 CACACTTGAAAAAGTTTTAATGG - Intergenic
911086478 1:93981701-93981723 CAGGGATATAATATTTTTAAAGG + Intergenic
911461397 1:98195567-98195589 CTGACCCAAAATAGTTTTAAAGG + Intergenic
911557151 1:99358672-99358694 CATGCTAAAAATTGTTTTAAAGG + Intergenic
911702469 1:100969664-100969686 AAGGCTTAAAATATTTTTTCAGG - Intronic
911755612 1:101551035-101551057 CAGGATTTTAATAGTTTGAATGG - Intergenic
912044126 1:105433880-105433902 CAAGCTTAAATTATTTTTAATGG - Intergenic
912407965 1:109457438-109457460 CAGTCTTAAAAAATCTTTAAAGG - Intergenic
913521686 1:119650476-119650498 AAGGCAAAAAATAGTTTCAATGG - Intergenic
913977388 1:143472882-143472904 CAGCCTAAAAGCAGTTTTAATGG + Intergenic
914071792 1:144298513-144298535 CAGCCTAAAAGCAGTTTTAATGG + Intergenic
914107363 1:144667843-144667865 CAGCCTAAAAGCAGTTTTAATGG - Intergenic
915806719 1:158861516-158861538 CTGGCTTGATATAGTTTTACTGG - Intergenic
916707405 1:167365656-167365678 TAGGCTTTAAATAATTTAAAAGG - Intronic
918197791 1:182238652-182238674 CAGGCTAACAAGAGTTTTGAGGG - Intergenic
918338965 1:183551619-183551641 CTGGTTTAAAATAGTCTTAATGG + Intronic
918553118 1:185766931-185766953 CAAGCTTCAAAATGTTTTAAGGG + Intronic
918571026 1:185992710-185992732 TTGTGTTAAAATAGTTTTAAAGG - Intronic
918697740 1:187564199-187564221 CATGCATAACATAGTTTTAGGGG + Intergenic
920392356 1:205616254-205616276 AAAGCTCAAAATATTTTTAAAGG + Exonic
920625860 1:207598209-207598231 TACCCTTAAAATGGTTTTAATGG + Intronic
921978125 1:221225690-221225712 CAGGCTCAGAATAGTATCAAAGG - Intergenic
922477691 1:225918086-225918108 CAGCCTTAAAATAGTTATTAGGG - Intronic
922524271 1:226286909-226286931 TAGGCTTAAGAGAGTTTTCAGGG - Intronic
923938147 1:238787895-238787917 CTTGATTAAAATAGGTTTAAAGG - Intergenic
924866253 1:247984749-247984771 CACACTTAAAATAGTTAAAATGG - Intronic
924870054 1:248032373-248032395 AACACTTAAAATAGTTTAAATGG - Intronic
1065000281 10:21332137-21332159 CAGGTCAAAAATAGTTTTAAGGG + Intergenic
1065168370 10:23004359-23004381 CAGACTTCAAACAATTTTAAGGG + Intronic
1066072767 10:31837203-31837225 TACATTTAAAATAGTTTTAAAGG + Intronic
1066160878 10:32726548-32726570 AATGATGAAAATAGTTTTAATGG - Intronic
1068803164 10:61164497-61164519 CAGGGTTAAAAATGTTTCAATGG + Intergenic
1069220742 10:65879800-65879822 CAGGATTGTAATATTTTTAAAGG - Intergenic
1069377547 10:67809134-67809156 GTGGCATAAGATAGTTTTAACGG + Intronic
1069910507 10:71755934-71755956 TAGGCTTAAAATGGTTGAAATGG + Intronic
1070014347 10:72510977-72510999 CAGGGTGAAAATAGCTATAAAGG - Intronic
1070027185 10:72642926-72642948 CAGGATTACAATAATTATAATGG - Intergenic
1071047524 10:81400398-81400420 CATACTTAAAATACTTTCAAAGG - Intergenic
1071595533 10:86920419-86920441 CAAGATTAAAATGGTTTCAAAGG - Intronic
1072028088 10:91484949-91484971 GAGGATTATAATAGTATTAAAGG - Intronic
1073705442 10:105978561-105978583 CAGCCTAAAAATATTTTTAGAGG - Intergenic
1073892121 10:108113840-108113862 ATTGCTTAAAATGGTTTTAAGGG - Intergenic
1074934229 10:118161905-118161927 AAGACTTAAATGAGTTTTAAAGG + Intergenic
1075776362 10:124991449-124991471 TAGGCTCAAAATACTTTTGAGGG + Intronic
1076821335 10:132941493-132941515 CAGGCTTAAAATCGTTCTTAGGG - Intronic
1079120514 11:17680789-17680811 CAGGCTTCACATGCTTTTAAAGG - Intergenic
1079663611 11:23074420-23074442 CACGTTTAATAAAGTTTTAATGG - Intergenic
1079774222 11:24503130-24503152 CAGTTTTAAAATAGCTTTAGTGG + Intronic
1080355158 11:31435366-31435388 CAGGTTAAAAATAATATTAAAGG - Intronic
1080360793 11:31510555-31510577 CAGGCTCAAAATACTTTATAAGG - Intronic
1080667301 11:34346935-34346957 CAGACTAAAAAAAGTTGTAAAGG + Intronic
1080894782 11:36440130-36440152 CAAGCAGAAAATACTTTTAAGGG - Intronic
1080909883 11:36585332-36585354 CAGGATTAAAATAGATATCATGG - Intronic
1081466049 11:43318308-43318330 CATGCTTAAAAAATTTGTAATGG - Intronic
1081491610 11:43573830-43573852 CAGGCTAAACATGTTTTTAAAGG - Intronic
1081762931 11:45589796-45589818 CAAGTTTAAAATAGTTTTGGAGG - Intergenic
1086200707 11:84198115-84198137 GAAGCTTAAATTAGTTTTCAAGG - Intronic
1086492308 11:87367985-87368007 CAGTATTAATATATTTTTAATGG + Intergenic
1086605597 11:88692713-88692735 CATGCCTAAAATAGACTTAATGG + Intronic
1087053734 11:93911193-93911215 CATACTTAAAATAGTTAAAATGG - Intergenic
1087427556 11:98010211-98010233 TAGAGTTAAAACAGTTTTAAAGG - Intergenic
1089320197 11:117620645-117620667 CAGGCCTAAAACAGGTTTATAGG - Intronic
1090380834 11:126326502-126326524 CAGGCTTAGAATAGTGTTATAGG + Intronic
1091579118 12:1770523-1770545 CAGGTTTTATATAATTTTAATGG + Intronic
1092842656 12:12558079-12558101 CAGGATTATAAGAATTTTAAGGG - Intronic
1093794859 12:23299404-23299426 ATGGCTTAAAATACTTTTATGGG + Intergenic
1094150268 12:27275057-27275079 CAGACTTAAAATCTTTTAAATGG + Intronic
1094560456 12:31548001-31548023 CAGCCTCTAAAAAGTTTTAAAGG + Intronic
1094591486 12:31825773-31825795 CATGCTAAAAAAAGCTTTAATGG - Intergenic
1094737888 12:33255837-33255859 TAGGCTTAATGTAGATTTAATGG - Intergenic
1096547574 12:52351227-52351249 CAGGATTAAGTGAGTTTTAATGG + Intergenic
1098072737 12:66693527-66693549 AAGGCCTAAAATAGATTCAAGGG - Intronic
1098564688 12:71919825-71919847 CAGGCATAAATGGGTTTTAAAGG + Intronic
1099231272 12:80028174-80028196 CAGGTCTAGAATAATTTTAAAGG + Intergenic
1099372981 12:81860695-81860717 GAGGCTTAAAAATCTTTTAAAGG + Intergenic
1102842454 12:116140047-116140069 TACTCTTAAAATAGTTTTAAAGG - Intronic
1104061942 12:125276009-125276031 CAGCCTAAAATTATTTTTAAAGG + Intronic
1104708056 12:130962990-130963012 AAGCCTTAAAATATTTCTAAAGG + Intronic
1106214908 13:27688126-27688148 CAGTCTTCAAAAATTTTTAAGGG + Intergenic
1106644635 13:31618901-31618923 CAGGTTTTTAATACTTTTAATGG + Intergenic
1106988605 13:35387597-35387619 CAGGCTTAATTTGGATTTAATGG + Intronic
1107867879 13:44720697-44720719 CTGGCTTTAATTAGTTATAATGG - Intergenic
1108157348 13:47599501-47599523 GAGACTTAAATTATTTTTAAAGG - Intergenic
1108556154 13:51594926-51594948 GAGTCTTAAAATAGTCTTAATGG - Intronic
1109123349 13:58486660-58486682 AATGTTTAAAATATTTTTAAAGG + Intergenic
1109402737 13:61856854-61856876 CAGACTCAAAATAGATTCAAGGG + Intergenic
1109771536 13:66981014-66981036 CACGTTTAAAATAGATTTTATGG - Intronic
1110267080 13:73550924-73550946 GAAGCTTAATATACTTTTAAAGG - Intergenic
1111691840 13:91573615-91573637 CAGGTTTAAAACAATTTTATAGG - Intronic
1114902502 14:27081975-27081997 CAGAAATAAAATAATTTTAAGGG + Intergenic
1116139861 14:40978372-40978394 CAAGCTGAATATAGTTTTCAGGG - Intergenic
1117643008 14:57820336-57820358 TAGGCTGAAAAGAGTTTTTAGGG + Intronic
1117858632 14:60064443-60064465 CTGTCTGGAAATAGTTTTAAAGG + Intergenic
1120015204 14:79465743-79465765 CTGCTTTAAAAGAGTTTTAAGGG + Intronic
1120346381 14:83296024-83296046 CTGATTTTAAATAGTTTTAAAGG - Intergenic
1121704968 14:95984842-95984864 CAGTTTTAAAATAGTTTTTTGGG + Intergenic
1122334006 14:100954872-100954894 CAGGATTGAAATATTTTTCACGG - Intergenic
1202840512 14_GL000009v2_random:116711-116733 ATGACTTAAAAAAGTTTTAAAGG - Intergenic
1202909889 14_GL000194v1_random:106904-106926 ATGACTTAAAAAAGTTTTAAAGG - Intergenic
1125823684 15:42657054-42657076 CAGGCAAAAAATAGGTTTTAAGG + Intronic
1126032573 15:44513799-44513821 CAGAATGTAAATAGTTTTAATGG + Intronic
1126322284 15:47437847-47437869 CATGAATAAAATAATTTTAAGGG - Intronic
1126424785 15:48515546-48515568 CATAGTTAAAATAATTTTAATGG - Intronic
1126440372 15:48682170-48682192 TAGGCTTTGATTAGTTTTAATGG - Intergenic
1127035037 15:54906588-54906610 CACACTTAAAATAGTTTTAATGG + Intergenic
1129164214 15:73767145-73767167 CAGGATTAAAATAGATACAAAGG + Intergenic
1129816029 15:78555299-78555321 CAGCCTAAAAATACTCTTAAAGG + Intergenic
1130579211 15:85120080-85120102 AAGCTTTAAAATAGTTTTAATGG + Intronic
1130708547 15:86256560-86256582 CAGACTTAAAATTCTTTCAAGGG - Intronic
1131703361 15:94965246-94965268 CAGGGTTAAGAGAGTTTGAAAGG + Intergenic
1132088807 15:98930671-98930693 CAAGCTGAAACTAGTTTAAAAGG - Intronic
1132999913 16:2844220-2844242 CAGTCTTAAAATAGCTCAAAGGG - Intergenic
1133620484 16:7521376-7521398 CTGGCTTAAACTCTTTTTAATGG - Intronic
1134756658 16:16673181-16673203 CAGGCCAAAATGAGTTTTAAAGG - Intergenic
1134989410 16:18685982-18686004 CAGGCCAAAATGAGTTTTAAAGG + Intergenic
1135413132 16:22250077-22250099 CAGCCTTAAAATATTTGTAGAGG + Intronic
1136984916 16:35092796-35092818 TCAGCTTAAAAAAGTTTTAAGGG + Intergenic
1137991896 16:53165516-53165538 CAAGATGAAAATAATTTTAAAGG + Intronic
1140861351 16:79021028-79021050 CAAGCTTCAAAAAGTTTTCAGGG + Intronic
1143160942 17:4870526-4870548 CTGGCCTAAAATATTTTAAAAGG - Intronic
1144501389 17:15788695-15788717 CATGCTTAGAATAGTTTCTAAGG + Intergenic
1144820784 17:18072520-18072542 CAGCCTTAAAATTTTTATAATGG + Intergenic
1145163564 17:20591368-20591390 CATGCTTAGAATAGTTTCTAAGG + Intergenic
1148930346 17:51122107-51122129 CAGGATAAACATAGGTTTAAGGG + Intergenic
1150361314 17:64536944-64536966 CAGGCTTAAAATCATTTTAATGG - Intronic
1150942234 17:69705639-69705661 CAGGCTTAGCAAAGTTTTAAAGG - Intergenic
1152063046 17:78093383-78093405 CAGGGTTGGAATAGTTTTACCGG - Intronic
1153403678 18:4710394-4710416 CAGCTTGAAAATAGTTTAAAAGG + Intergenic
1153440684 18:5116066-5116088 GAGGCTTAAAAAAGTCTTACAGG + Intergenic
1153912250 18:9714568-9714590 CAGGCTTAATTAAATTTTAAAGG - Intronic
1155114030 18:22747066-22747088 AAGTTTTAAAATTGTTTTAAAGG + Intergenic
1155226123 18:23730806-23730828 CAGGCTTAGAATAATCATAAAGG - Intronic
1155929195 18:31687601-31687623 CAGGATTAAGATCTTTTTAATGG - Intergenic
1155952159 18:31925058-31925080 AAGGCTAAGAATAGGTTTAAGGG - Intronic
1158616681 18:58994341-58994363 CCGGCTGAAAATACTTTTGAAGG + Intergenic
1159863589 18:73678460-73678482 CTCTCTTAAAATATTTTTAAAGG - Intergenic
1161996366 19:7714697-7714719 TATGCTTAAAATAGTTAAAATGG - Intergenic
1164897295 19:31888027-31888049 CATGCTTAAAATAAAATTAAAGG + Intergenic
1167329497 19:48846154-48846176 CAGCCTTAAAAAGTTTTTAAGGG - Intronic
1167730113 19:51247837-51247859 CAGGATTAAACAAGTTTTACTGG - Intronic
1168402571 19:56093997-56094019 AAAGATTAAAACAGTTTTAAAGG - Intronic
926454613 2:13050540-13050562 CAGGCTTAAAAAACATTAAAAGG + Intergenic
926521143 2:13915634-13915656 CAGGATTTTAAGAGTTTTAATGG + Intergenic
928732508 2:34248111-34248133 CAGGCTTGATATATTTTTACTGG + Intergenic
929066557 2:37981519-37981541 CAGCCTTGAAATATATTTAAGGG + Intronic
929401605 2:41588792-41588814 CATGTTTAAAATAGTTACAAAGG + Intergenic
929542559 2:42833682-42833704 CAGGCTTAAAAAATTTTTTTTGG + Intergenic
930547165 2:52782916-52782938 CAAGCTTAAAGTAGTATTCATGG - Intergenic
931834027 2:66080454-66080476 GAGGATTAAAATTGTTTCAAGGG + Intergenic
932531282 2:72535939-72535961 CAGGCTAAAAGTAGTGTTATAGG + Intronic
933374800 2:81465992-81466014 TAGTTTTAAAATAGTTTTGAGGG - Intergenic
934182095 2:89633880-89633902 CAGCCTAAAAGCAGTTTTAATGG + Intergenic
934292393 2:91708088-91708110 CAGCCTAAAAGCAGTTTTAATGG + Intergenic
935030134 2:99313664-99313686 CAGGCTAACAATAATTTTGATGG - Intronic
936032459 2:109083152-109083174 TATGCTTAAAATGGTTTAAATGG - Intergenic
936103342 2:109602855-109602877 CAGGCTTTAAGTCCTTTTAATGG - Intronic
938168301 2:129052077-129052099 CACACTTAAAATGGTTATAATGG + Intergenic
938628961 2:133144091-133144113 CAAGATTACAATATTTTTAATGG - Intronic
940188659 2:151014931-151014953 CAGGTTTAAAATATATTTATTGG + Intronic
940557249 2:155245974-155245996 CAGTCTTACAATAATTTTAAAGG + Intergenic
940641006 2:156343958-156343980 TCCTCTTAAAATAGTTTTAATGG - Intergenic
941775156 2:169385382-169385404 CAAGCTAAAGATAGTTTTTACGG + Intergenic
941937399 2:170995628-170995650 CACAGTTAAAATATTTTTAAAGG + Intronic
942279881 2:174349642-174349664 CACGCTTTGAATAATTTTAAAGG - Intronic
942363252 2:175195299-175195321 AAGCCTTAAAAAAGTTTTACTGG - Intergenic
942396849 2:175558789-175558811 CATGGTTGAAATAATTTTAAAGG + Intergenic
942712269 2:178850173-178850195 AAGGATGAAACTAGTTTTAAAGG + Intronic
942762236 2:179412892-179412914 CGGCCTAAAAATATTTTTAAAGG - Intergenic
942795583 2:179814728-179814750 AAGGCTTGAAATAGTTTAAAAGG - Intronic
943044710 2:182846533-182846555 CAGTCTTGAAAAAGTTATAAAGG - Intronic
943259846 2:185645298-185645320 CAGGCTTAAAATAGGATTCTCGG - Intergenic
943562008 2:189474916-189474938 AAGTTTTAAAATAGATTTAAAGG + Intronic
943843266 2:192605914-192605936 CATGCTTAAAATATTTTGAAAGG - Intergenic
946599207 2:221340863-221340885 CAGCCTTAAAATTATTTTCAGGG - Intergenic
947367497 2:229412182-229412204 CAGGCTTGAACTAGTTTTGAAGG + Intronic
1169253409 20:4078492-4078514 CACACTTAAAACAGTGTTAAGGG - Intergenic
1171220378 20:23391792-23391814 CATGCTAAAAATGGTTTTTACGG - Intronic
1172036272 20:32012986-32013008 AAGGCTTAAAAAAATCTTAATGG + Intronic
1172706440 20:36885734-36885756 AAGAGTCAAAATAGTTTTAAAGG - Intronic
1173452153 20:43174385-43174407 CATGCTTTAAATACTTGTAATGG - Intronic
1173647890 20:44644916-44644938 CACACTTAAACTCGTTTTAAAGG + Intronic
1174534257 20:51238485-51238507 TAGGATTAAACAAGTTTTAATGG - Intergenic
1174772229 20:53311192-53311214 ATGGCTTAAAAGATTTTTAATGG - Intronic
1174968739 20:55249655-55249677 CAGGCTTTAAATAGGATGAAGGG + Intergenic
1176584348 21:8563712-8563734 CATGCTGAAGATCGTTTTAAAGG + Intergenic
1176629241 21:9121608-9121630 ATGACTTAAAAAAGTTTTAAAGG - Intergenic
1176667051 21:9697306-9697328 CAGGCTGAGAATGGTTTTTATGG + Intergenic
1176697718 21:10000939-10000961 CAAGATTTAAATTGTTTTAAAGG + Intergenic
1176730374 21:10489355-10489377 CAGCCTAAAAGCAGTTTTAATGG - Intergenic
1178350635 21:31871021-31871043 CAGGCTTGAAAAAGATTTAATGG + Intergenic
1180267160 22:10540616-10540638 CATGCTGAAGATCGTTTTAAAGG + Intergenic
1182308325 22:29387080-29387102 CAATCTTCAAATAGTTTTCACGG + Intronic
1182345337 22:29659623-29659645 TATGCTTAAAACAGTTTAAAAGG + Intronic
949516926 3:4815852-4815874 AAAGCTTAAAAAGGTTTTAAGGG - Intronic
949544237 3:5058717-5058739 CAGGCTTAGCATATTTTTCAGGG + Intergenic
950286686 3:11750774-11750796 CAGGCTGACAACAGTTTTATTGG + Intergenic
950790684 3:15469333-15469355 CAAGCTTAAAATATTATGAATGG + Intronic
951504418 3:23427067-23427089 TAGGCTTCGATTAGTTTTAAAGG + Intronic
952108419 3:30095035-30095057 AGGGATTAAAATAATTTTAATGG + Intergenic
952934601 3:38386367-38386389 CAGGCAATAAATATTTTTAAAGG + Intronic
955572864 3:60326704-60326726 CAGGCAGAAAATACTGTTAAGGG - Intronic
958054161 3:88387658-88387680 TATACTTAAAATATTTTTAAAGG - Intergenic
959335793 3:105063526-105063548 TAGGCTTAACATATATTTAATGG - Intergenic
960498565 3:118407058-118407080 CAGTCTGAAAATGGTTTGAAAGG + Intergenic
963664794 3:148169223-148169245 TAGGTATAGAATAGTTTTAAAGG + Intergenic
964428227 3:156575802-156575824 CAGGCTTATAAGAGTTCTAAAGG + Intergenic
964496941 3:157301597-157301619 CAGTTTTAATAGAGTTTTAAGGG - Intronic
965694177 3:171389911-171389933 CAGCCTCAAAATAGATGTAATGG - Intronic
967905286 3:194494579-194494601 CAGCCTCAAAGTACTTTTAATGG - Intronic
970252507 4:14130740-14130762 CTGGCATAAACTGGTTTTAAAGG - Intergenic
970354408 4:15237775-15237797 CAGAATCAAAATAGTCTTAAAGG + Intergenic
971347032 4:25821058-25821080 TAGGTTTAAAATTGTTTTGAAGG - Intronic
972035088 4:34509739-34509761 TAGGATTAAACAAGTTTTAATGG - Intergenic
975004957 4:69272454-69272476 CCGACTTAAAAGAGTTTAAAAGG + Intergenic
975863014 4:78697788-78697810 CTGGCTCAAAAAACTTTTAAAGG + Intergenic
975939851 4:79629527-79629549 CAGCATGAAAATAGTTTGAAAGG - Intergenic
976516170 4:85969777-85969799 CAGACCTAAAATAGTCTCAATGG - Intronic
976777675 4:88723701-88723723 CAGGCTTAGCATATTTCTAATGG + Intergenic
977147064 4:93456898-93456920 CATGCTTACAAAAGGTTTAAGGG - Intronic
978304246 4:107305088-107305110 AGGGCTTAAGATCGTTTTAATGG - Intergenic
978873778 4:113612833-113612855 GAGGCTAAAAATAGTTCCAAAGG + Intronic
978949981 4:114546422-114546444 ACGTCTTAAAAAAGTTTTAATGG + Intergenic
979103061 4:116647278-116647300 AAGGCTTAAATGAGTCTTAAAGG - Intergenic
979197563 4:117938934-117938956 CAGTGTTAAAGTAGTGTTAAGGG - Intergenic
979923467 4:126529357-126529379 AAGGCTTAAAATAATTTTGTTGG - Intergenic
980187325 4:129478520-129478542 CAGCCCAAAAATATTTTTAATGG + Intergenic
980370265 4:131860814-131860836 CAAGATTTAAATTGTTTTAAAGG + Intergenic
981034275 4:140153400-140153422 AAGGATTAAAATAGTTTAAGTGG + Exonic
981695628 4:147556257-147556279 CATTCTTAGAATAGTTATAATGG - Intergenic
982242999 4:153319425-153319447 CAGGGTTAAAATATTTTTGCTGG + Intronic
985407962 4:189655031-189655053 CAGGCTGAGAATGGTTTTTATGG - Intergenic
985419324 4:189768026-189768048 GCGGCATAAAAGAGTTTTAAAGG - Intergenic
986064397 5:4221731-4221753 CAGACACAAAATATTTTTAAAGG - Intergenic
986156949 5:5185411-5185433 CATGCCAAAAATATTTTTAAAGG + Intronic
986453242 5:7888027-7888049 CAGGATGGAAAGAGTTTTAATGG + Intronic
986510491 5:8501518-8501540 CAGGCTTAAAATGTCTTTGAAGG - Intergenic
988250102 5:28745977-28745999 CAGTATTGAAATAGTTTCAAGGG - Intergenic
988522928 5:31962563-31962585 CAGGCTCAAAATAGGTTCCAGGG - Intronic
988992197 5:36682422-36682444 CAGGCCCAAAGTAGTTATAATGG + Intronic
990797551 5:59561625-59561647 CAGTGTTAAAATATTTTAAAAGG + Intronic
991034308 5:62112765-62112787 CCTGCTTAAAATGCTTTTAAAGG + Intergenic
993132610 5:83918283-83918305 CAGGGTAAATTTAGTTTTAAAGG - Intergenic
993182338 5:84570399-84570421 CAGGCTTATAAACCTTTTAATGG + Intergenic
993283781 5:85962519-85962541 CAGGCTTATGATAGCTTTAGAGG - Intergenic
994041167 5:95261565-95261587 CAGGCTTAAAATAACATTTATGG - Intronic
994183573 5:96794611-96794633 CAAACATACAATAGTTTTAAGGG + Intronic
994203293 5:97003222-97003244 CTGTCTTAAAATTATTTTAAAGG - Intronic
994383860 5:99104168-99104190 CAAGCTTAAAATAATTGTACAGG + Intergenic
995065687 5:107859294-107859316 GAGGCTTAAAATAATTTTTCTGG - Exonic
995482171 5:112604275-112604297 CAGGCATATAATAGATATAAAGG - Intergenic
997553063 5:134770512-134770534 CGGCCTTAAAATACTTTTACAGG - Intronic
997710964 5:136004331-136004353 CAGGCTTTAGAAAGTTTTGAAGG - Intergenic
997812116 5:136980866-136980888 CAGGCTCAAGATATTTTTATGGG - Intronic
998361956 5:141595880-141595902 AAGGCTTAAAAAAATTTTTAGGG + Intronic
998575081 5:143306523-143306545 AAGGCTTAAAAAAGTTCTTAGGG - Intronic
999071306 5:148746486-148746508 TATACTTAAAATATTTTTAAGGG + Intergenic
999500446 5:152141736-152141758 CAGGCTTATGATAGTTTAATGGG - Intergenic
1000364955 5:160481928-160481950 TAGGATTAAACAAGTTTTAATGG - Intergenic
1000542743 5:162560580-162560602 CATGCTTAAAATACTTTCTATGG - Intergenic
1003567647 6:7234119-7234141 CAGGCTTAAACTATTTTAACAGG - Intronic
1003672300 6:8170748-8170770 CAGGTTTTATATGGTTTTAAAGG + Intergenic
1003793646 6:9575652-9575674 CAGGCTCCAAATGGTTTTGATGG + Intergenic
1004197779 6:13520770-13520792 CAGGCTTTATATAATTTCAAAGG - Intergenic
1005353292 6:24958353-24958375 AAGGCTAAAAATAGATCTAATGG - Intronic
1005882285 6:30070825-30070847 CAGGCCTAGAATGGTTTGAATGG + Exonic
1006281544 6:33058218-33058240 CAGGAGTAAAATAGTTCAAAGGG - Intergenic
1006614130 6:35313274-35313296 TACGCTTAAAATAGTTAAAATGG - Intronic
1008556090 6:52673917-52673939 CAAGCTTAAAATAGGTGTAAGGG + Intronic
1008793291 6:55266673-55266695 CAACCTTGAAAGAGTTTTAAAGG - Intronic
1009593071 6:65699811-65699833 CTGTTTTAATATAGTTTTAAGGG - Intronic
1009690250 6:67021344-67021366 CAGGCTTAATTTAGATTGAAAGG - Intergenic
1009818329 6:68766641-68766663 CATGTTTACAATAGTTTTTAAGG - Intronic
1011092089 6:83614998-83615020 CAAGCATAAAATGATTTTAAAGG + Intronic
1014206625 6:118663026-118663048 AATGCTTAAAATAATTTTCATGG + Intronic
1014245708 6:119066242-119066264 AAGTCTGAAAATAGTTTTACTGG + Intronic
1016031334 6:139341847-139341869 CAGCCTAAAAATATATTTAAGGG - Intergenic
1016380031 6:143468194-143468216 CATCCTTAAAATATTTATAAAGG + Intronic
1016408284 6:143755036-143755058 CAGGCTTCTAAAACTTTTAAAGG - Intronic
1017189510 6:151636747-151636769 CAGGGTCCAAATAGTTTTATAGG - Intergenic
1017708171 6:157143727-157143749 AAGGCTTAAAACGGTTTAAAAGG - Intronic
1018289630 6:162278608-162278630 AAGGCTTAAAAAAGCTATAAAGG + Intronic
1021175417 7:17444319-17444341 CAGGCTGGAAAATGTTTTAATGG + Intergenic
1021610704 7:22455158-22455180 CAGCCTTAAAAATATTTTAAAGG + Intronic
1027006854 7:74701809-74701831 CAATCTTAAAATGTTTTTAAGGG + Intronic
1027611193 7:80363009-80363031 CAGGATAATAATAGTTTGAATGG - Intergenic
1028710783 7:93905340-93905362 CAAGTTTAAGATAATTTTAAGGG - Intronic
1028755726 7:94431954-94431976 CAAGATTCAATTAGTTTTAAAGG + Intergenic
1028760193 7:94487498-94487520 CAGGATTTAATTATTTTTAATGG + Intergenic
1028921875 7:96318652-96318674 CTTCCTTTAAATAGTTTTAATGG - Intronic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1030358833 7:108573252-108573274 CAGACTGAAAATAGATTTCATGG + Exonic
1031824682 7:126548632-126548654 CAGGGTTAAAATAGATATAAAGG + Intronic
1032816452 7:135479951-135479973 CAGAATTTAATTAGTTTTAAAGG - Intronic
1033101030 7:138472233-138472255 CAGGCTTAAAAACATTTAAATGG + Intronic
1033967253 7:146991083-146991105 AAGGTTTAAAAAACTTTTAAAGG + Intronic
1036098345 8:5750023-5750045 CAGGAGTAAATTATTTTTAATGG + Intergenic
1037191654 8:16133321-16133343 CACTCTCAAAATATTTTTAAAGG - Intronic
1037349810 8:17940342-17940364 AACACTAAAAATAGTTTTAATGG + Intronic
1037728996 8:21507626-21507648 CAGACTTTAACTAGATTTAATGG - Intergenic
1038609533 8:29047290-29047312 CAAGAATAAACTAGTTTTAAGGG - Intronic
1038925419 8:32133886-32133908 CAGGTTGAAAATACTTTTATGGG + Intronic
1038968715 8:32606830-32606852 CAGAGTTAAAGTAATTTTAAGGG + Intronic
1040350425 8:46561299-46561321 AAGTCTTAAAAATGTTTTAAAGG - Intergenic
1040893755 8:52343796-52343818 CATCCCTAAAATACTTTTAAAGG + Intronic
1041042267 8:53859419-53859441 CAGATTTTAAATGGTTTTAATGG + Intronic
1041492546 8:58450706-58450728 CAGGCATAAAAGAGTTTTCTAGG - Exonic
1041523691 8:58782453-58782475 CTGGCTTAAAATGTTTTCAATGG - Intergenic
1042235672 8:66611610-66611632 AAGGCTGAAAACAGTTTTAGAGG + Intronic
1042246121 8:66710538-66710560 CAGTCTAAAATTGGTTTTAAGGG - Intronic
1044078490 8:87854933-87854955 CAGGCCTAGAAGAGTTTTTAAGG + Intergenic
1044474028 8:92605262-92605284 CTGGCTTTAAATAGGGTTAATGG + Intergenic
1045831134 8:106461635-106461657 CAGGCTTAAAATAGTTTTAAAGG - Intronic
1045866849 8:106876567-106876589 TAAGGTTAAAATAATTTTAAAGG + Intergenic
1046208419 8:111035289-111035311 TAGGATAAAAATAATTTTAATGG - Intergenic
1050193997 9:3061255-3061277 CAGGCATAAAATAATTCAAATGG + Intergenic
1050369687 9:4908389-4908411 CAGTTTTAAAATAGATTTCATGG + Intergenic
1050537473 9:6643638-6643660 TAGGTTTAAAATATTTTTAATGG - Intronic
1050685557 9:8164518-8164540 CAAGGTTAAAATATTTTCAAAGG - Intergenic
1050898588 9:10914960-10914982 CAGGGTCAACATAGTCTTAAAGG + Intergenic
1050986883 9:12093412-12093434 CACACTTAAGATATTTTTAAAGG + Intergenic
1051022792 9:12565296-12565318 CAGGCTTAAATAGGTGTTAAGGG - Intergenic
1051515585 9:17926871-17926893 AAGTTTTAAAATAATTTTAATGG - Intergenic
1053634844 9:39987303-39987325 CAAGATTTAAATTGTTTTAAAGG + Intergenic
1053771082 9:41477031-41477053 CAAGATTTAAATTGTTTTAAAGG - Intergenic
1054209043 9:62263394-62263416 CAAGATTTAAATTGTTTTAAAGG - Intergenic
1054315769 9:63584745-63584767 CAAGATTTAAATTGTTTTAAAGG + Intergenic
1055841525 9:80511187-80511209 CAGGCTAGAAATAGTGATAACGG + Intergenic
1056057658 9:82844265-82844287 CAGGAATAAAATTTTTTTAAAGG + Intergenic
1057634658 9:96752875-96752897 CAAGCCTAAATGAGTTTTAAAGG - Intergenic
1059873299 9:118602275-118602297 CAGGCTCACAATACTTTTAGGGG - Intergenic
1059982258 9:119785815-119785837 CATTCTCAAAATGGTTTTAAAGG + Intergenic
1060239326 9:121889393-121889415 CACACTTAAAATAGTTAAAATGG - Intronic
1060431517 9:123554920-123554942 CTGTCTTATGATAGTTTTAATGG - Intronic
1062219346 9:135406087-135406109 CAAGTTTAAAATGGTTTTCATGG - Intergenic
1203752083 Un_GL000218v1:89282-89304 ATGACTTAAAAAAGTTTTAAAGG - Intergenic
1203583909 Un_KI270746v1:44713-44735 CAGCCTAAAAGCAGTTTTAATGG + Intergenic
1203659045 Un_KI270753v1:24456-24478 CAGGCTGAGAATGGTTTTTATGG - Intergenic
1185873998 X:3687295-3687317 CAGACTTAACTTACTTTTAATGG + Intronic
1187177133 X:16906017-16906039 CTGTCTGAAAAAAGTTTTAATGG + Intergenic
1187899440 X:24013559-24013581 CAGGCTTGAATTATTTTTAAAGG + Intronic
1191947107 X:66546663-66546685 CATGCTAAAAATTGTTTTAAAGG - Intergenic
1195691237 X:107627566-107627588 CATGCTTAAAATATGCTTAATGG + Intergenic
1198318255 X:135491478-135491500 CTGGCTTAATATAATTTTAAAGG + Intergenic
1198407055 X:136323820-136323842 CAAGCAAAAAATAGTTATAAGGG - Intronic
1199651836 X:149952621-149952643 CTGGCCTAAAACATTTTTAATGG + Intergenic
1200384588 X:155877857-155877879 CAGGCAAAAAATTTTTTTAAAGG - Intergenic
1201380003 Y:13365165-13365187 GAGTCTTAAAAGGGTTTTAAAGG - Intronic
1201755007 Y:17477760-17477782 CAGACTGAAGATAGTTTTACTGG + Intergenic
1201846545 Y:18428225-18428247 CAGACTGAAGATAGTTTTACTGG - Intergenic