ID: 1045839982

View in Genome Browser
Species Human (GRCh38)
Location 8:106568412-106568434
Sequence TATTGGGAGGAGAGGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 576}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045839982_1045839989 12 Left 1045839982 8:106568412-106568434 CCTTCCATCCTCTCCTCCCAATA 0: 1
1: 0
2: 3
3: 52
4: 576
Right 1045839989 8:106568447-106568469 ATTCTGGAGAATGTACTAGACGG No data
1045839982_1045839988 -4 Left 1045839982 8:106568412-106568434 CCTTCCATCCTCTCCTCCCAATA 0: 1
1: 0
2: 3
3: 52
4: 576
Right 1045839988 8:106568431-106568453 AATAGAAAAGACTACAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045839982 Original CRISPR TATTGGGAGGAGAGGATGGA AGG (reversed) Intronic
900649985 1:3725943-3725965 TAATGGGGGGAGTGGATGGATGG + Intronic
900650055 1:3726181-3726203 AAATGGGGGGAGTGGATGGATGG + Intronic
900727393 1:4225846-4225868 AGTTGGTAGGAGAGGATGCAAGG - Intergenic
901321805 1:8344642-8344664 TATTTGGATGAGTGGATGGATGG - Intergenic
901321822 1:8344738-8344760 TATTTGGATGAGTGGACGGATGG - Intergenic
901321863 1:8344960-8344982 TATTTGGATGAGTGGATGGATGG - Intergenic
901321880 1:8345056-8345078 TATTTGGATGAGTAGATGGATGG - Intergenic
902291813 1:15440348-15440370 TGGTGGGAGGAGAGGATGCCCGG + Exonic
902783932 1:18721100-18721122 GAGTGGGAGAAGAGGCTGGAGGG - Intronic
902898813 1:19499059-19499081 TCTTGGGAGGAGAAGACAGAAGG - Intergenic
903329470 1:22589873-22589895 TTTTGGGAGGAGATGGTGGGTGG - Intronic
903564313 1:24253320-24253342 TATTTTGAGGGGTGGATGGATGG - Intergenic
903983303 1:27205522-27205544 TTTTGGGAGGCGAAGATGGGTGG + Intergenic
904325303 1:29724182-29724204 TCCTGGGAGGAGAGAATGGTAGG - Intergenic
904881522 1:33701090-33701112 TACTGGAAGGACAGGATTGAGGG - Intronic
904891007 1:33779576-33779598 TTTCGGGAAGAGAGGATGGCAGG - Intronic
905928779 1:41771568-41771590 TTTTGGCAGGAGGGGCTGGAAGG + Intronic
906108962 1:43310902-43310924 TTTTGAGAGGAAAGGAAGGAAGG - Intronic
906369219 1:45238013-45238035 TTTTGGGAGGCCAGGATGGGAGG + Intronic
906457847 1:46012749-46012771 CTTTGGGAGGCCAGGATGGAAGG + Intronic
906642295 1:47448826-47448848 TATTGGGAGTAGAGAAGGGGAGG + Intergenic
907077989 1:51595333-51595355 TAGAGGGAAGGGAGGATGGAGGG - Intronic
908810031 1:67971973-67971995 TAATAGGAGGATAGGAAGGAAGG - Intergenic
910140653 1:84024036-84024058 TATGAGGAAGAGAGCATGGATGG - Intergenic
910624955 1:89296703-89296725 CATTGGCAGGGGAGGTTGGAGGG - Intergenic
911408779 1:97475521-97475543 TATTGGGAGAAAAGGATTAACGG + Intronic
912067519 1:105762888-105762910 TCTACGGAGGAGAGGATGTATGG + Intergenic
912416095 1:109509298-109509320 TTTTGGGAGGAGCTGAGGGAAGG + Intronic
912739910 1:112184691-112184713 TGTTAGGAGAAGAAGATGGAGGG + Intergenic
913531521 1:119737302-119737324 CAGAGGGAGGAGAGGAAGGAAGG + Intronic
913548415 1:119893167-119893189 TGGTGGGAGGAGAGGACTGAGGG - Intergenic
915042089 1:152977114-152977136 GATTGGCAGAGGAGGATGGAAGG + Intergenic
915484214 1:156208997-156209019 TATGGTGAGGGGAGGAGGGAAGG + Intronic
915630699 1:157152103-157152125 TATACGGAGGATAGGAAGGAAGG + Intergenic
916139127 1:161678164-161678186 TAGGGGGAGGAGAGGAGAGATGG + Exonic
916347817 1:163814094-163814116 TAATGGCAAGAGAGTATGGAGGG + Intergenic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916764798 1:167849969-167849991 GTTTGGGAGCAGAGCATGGAGGG + Intronic
917984521 1:180302036-180302058 TATTGGGGGGGGAGGGTGGAGGG + Intronic
918389632 1:184045202-184045224 GATGGGGAGGAGAAGAAGGAAGG + Intergenic
918561462 1:185872543-185872565 TGTTGGGGGGAGAGGATGGATGG + Intronic
918632599 1:186736051-186736073 TATTGGCAGGGGTGGATGAAGGG - Intergenic
919072476 1:192773436-192773458 TATTGGGAGAGGAGGAGGAAAGG - Intergenic
919604361 1:199663019-199663041 TGTTTGGTGGAGAGGATAGATGG - Intergenic
920282198 1:204852685-204852707 AGCTGGTAGGAGAGGATGGAAGG - Intronic
920519325 1:206612108-206612130 CATTTTGAGGTGAGGATGGAGGG - Intronic
920560658 1:206936070-206936092 TATTCTGAGCAGAGAATGGAAGG + Intronic
920588617 1:207194666-207194688 TTATGGGCAGAGAGGATGGAAGG + Intergenic
921485158 1:215706363-215706385 TTTTGGGAGGTCAGGCTGGATGG + Intronic
921967624 1:221107367-221107389 GAGTGGGAAGAGAGGAAGGAAGG - Intergenic
922072531 1:222209915-222209937 TTTTGGGAGAAGGAGATGGAAGG + Intergenic
922168244 1:223133732-223133754 TTTGAGGAGGAGGGGATGGATGG + Intronic
922852021 1:228740796-228740818 TGATGGGAGCAGAGTATGGATGG + Intronic
923051745 1:230394980-230395002 GAGTGGGAGGAGAGGAAGGGAGG - Intronic
923051881 1:230395418-230395440 GAGTGGGAGGAGAGGAGGGGAGG - Intronic
923281016 1:232442966-232442988 GATTGAGAGGAGAGAATGGCCGG - Intronic
923295461 1:232590672-232590694 TATTGGGAGGAATGCAGGGATGG - Intergenic
923401290 1:233617662-233617684 TTTTGGGAGGCCAGGGTGGAAGG + Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923937776 1:238782918-238782940 TGTTGGGAGAAGAGGAGGCATGG - Intergenic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
1063370750 10:5521349-5521371 TATTGGGGTGAGAGGCTGCAGGG + Intergenic
1063693071 10:8305702-8305724 AATAAGAAGGAGAGGATGGAGGG - Intergenic
1063757684 10:9033164-9033186 TCTTAGGAGGACAGGATGGCTGG - Intergenic
1063962942 10:11322099-11322121 TGTTGGGGGAAGGGGATGGATGG + Intronic
1064575672 10:16743885-16743907 TTTTGGGAGGACAAGGTGGAAGG + Intronic
1064863115 10:19848810-19848832 TTTTGGAAGGGGAGGATGGCAGG + Intronic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1069213039 10:65785428-65785450 TAGTGGGAGGAGTGGTTGGAGGG - Intergenic
1069594192 10:69659983-69660005 AATTGAGAGGAGAGGAGGGGTGG + Intergenic
1069616387 10:69809019-69809041 CCTTGGGAGTAGAGGATGGGAGG - Intronic
1069619603 10:69828683-69828705 AGTGGGGAGGAGAGGATGGAAGG - Intronic
1069666326 10:70162501-70162523 GAAGGGGAGGAGGGGATGGAAGG + Intronic
1069726814 10:70585542-70585564 TCTTGGGAGGAGAAGAAGGTGGG - Intergenic
1069947988 10:72000608-72000630 TGTTGGGAGAAGAGGTGGGAAGG + Intronic
1070691758 10:78532325-78532347 TATTAGAAGGAGAGAATAGAGGG + Intergenic
1072314542 10:94189406-94189428 TCTTGTGGGGAGAGGAGGGAAGG - Intronic
1073115198 10:101087883-101087905 CAGTGGGTGGAGAGGAAGGAGGG - Intergenic
1073659573 10:105459855-105459877 TTCTGGGAGAACAGGATGGATGG + Intergenic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074775834 10:116767502-116767524 TAGTGGGAGCAGAGAAGGGAGGG - Intergenic
1075049785 10:119174977-119174999 TATTGGGAGGGAAAAATGGATGG - Intronic
1075090093 10:119439325-119439347 AATTGGGAAGAGAGGATCAAAGG - Intronic
1075224936 10:120620517-120620539 GAAGGGGAGCAGAGGATGGAAGG - Intergenic
1075822634 10:125327881-125327903 GATTGGGGGAAGAGGATGAAAGG - Intergenic
1075925877 10:126251672-126251694 GATGGGATGGAGAGGATGGATGG + Intronic
1076227664 10:128793167-128793189 GATGGGGTGGAGAGGAAGGAAGG + Intergenic
1076601181 10:131657997-131658019 TGTTGGGAGGTGAGGATGTGGGG + Intergenic
1077869918 11:6253072-6253094 GAGGGGGAGCAGAGGATGGAGGG - Intergenic
1078269515 11:9781939-9781961 TTTTGGGAGGTGAAGGTGGACGG + Intronic
1078463047 11:11530079-11530101 GTTGGGGAGGAGGGGATGGAGGG - Intronic
1078641435 11:13100695-13100717 TATTGGGAGGAGAAGAATTATGG - Intergenic
1078855417 11:15202665-15202687 AAATGGGAGGAGAAGATAGAAGG + Intronic
1079448600 11:20579830-20579852 TAAGGGCAGGAGAGGATGGATGG + Intergenic
1079870260 11:25789752-25789774 TCTTGGAAGTTGAGGATGGATGG - Intergenic
1080252042 11:30244300-30244322 TGGTGGGTGGAGAGGGTGGAGGG + Intergenic
1080381460 11:31776040-31776062 GTTTGGGAGGAGAAGATGGGAGG + Intronic
1081713076 11:45230450-45230472 TGATGGGAGGAGCAGATGGAGGG - Intronic
1082028147 11:47587401-47587423 TATAGGGAGGGGAGGAGGGTGGG + Intronic
1082987953 11:59184118-59184140 ATTTGGGAGCAGAGAATGGATGG + Intronic
1083203850 11:61135662-61135684 TATTGGAAGGATGGGATGGGAGG - Intronic
1083300275 11:61736411-61736433 CACAGAGAGGAGAGGATGGATGG + Intronic
1083489315 11:63003452-63003474 TGTTGGGAGGAGATGGAGGAGGG + Intronic
1086406156 11:86500500-86500522 GGTTGGCAGGAGAGAATGGAAGG - Intronic
1086554331 11:88091175-88091197 TATTGGGAGCAGGGGATGGAGGG + Intergenic
1087013736 11:93537078-93537100 TATAGGGATGAGAGGGAGGAAGG - Intronic
1087046511 11:93848038-93848060 TATTTGGAGGAGGGGATTTAGGG - Intronic
1087270867 11:96110166-96110188 TGTTTTGAGGAGTGGATGGAAGG + Intronic
1087838588 11:102899204-102899226 TATTGGGAGGCAAGAATGTATGG + Intergenic
1088223323 11:107591620-107591642 AATTGGGAGGACAGGATAGAAGG - Intronic
1088232706 11:107689021-107689043 AAGTGGGAGGAGAAGCTGGAAGG - Intergenic
1088929762 11:114339844-114339866 TATGGGGAGCAGAGGGTGTATGG + Intergenic
1089431675 11:118430128-118430150 TTTTGGGAGGCTGGGATGGATGG + Intronic
1089588065 11:119522533-119522555 TTTTGGAAGGTGGGGATGGATGG + Intergenic
1090077086 11:123586385-123586407 ACTTGGGATGAGAGGGTGGAAGG - Intronic
1090583581 11:128185931-128185953 TATTGGGAGGAGAGAGTGAGAGG - Intergenic
1090860962 11:130651916-130651938 TTTGGGGAGGAGAGGATAGTGGG + Intergenic
1091054710 11:132407188-132407210 TATTGAGAAGGGAGGATCGATGG - Intergenic
1091724419 12:2835458-2835480 TAGGGGGATGAGAGGAGGGAAGG - Intronic
1091913620 12:4251618-4251640 GAGAGGGAGGAGAGGAGGGAGGG + Intergenic
1093547032 12:20360507-20360529 AATTGGGAGGAGAGGGTGCTTGG - Intergenic
1093617655 12:21247527-21247549 TAGTGGGAGTAGGGGGTGGATGG + Intergenic
1093844452 12:23951341-23951363 AATTGGGAGGGGAAGTTGGAAGG - Intergenic
1095464334 12:42475091-42475113 GATTGGGAGGAGGGGATGGTGGG - Intronic
1096111106 12:49029757-49029779 TTTTGGGAGGCCAAGATGGAAGG - Intronic
1096233350 12:49909751-49909773 TATGAGCAGGAGAAGATGGAAGG + Intergenic
1096263685 12:50107912-50107934 TCTTGGGAGGAAAAGAGGGATGG - Intronic
1096343416 12:50823341-50823363 AAGTGGGAGGAGGGGATGGCAGG - Intergenic
1096496500 12:52042140-52042162 TCTTGGCAGGATAGGCTGGAGGG + Intronic
1097261030 12:57720365-57720387 CAGTGAGAGGAGAGGATGGTTGG - Intronic
1097262849 12:57729220-57729242 TATTGGGAGAAGGGGCTGGGTGG + Intronic
1097704530 12:62853889-62853911 TATTGGGAAGAGAGGTAGGTAGG + Intronic
1098476270 12:70907800-70907822 TACTGGGAGGAGAGGTTGACAGG + Intronic
1099941764 12:89197414-89197436 GATAGGTAGGATAGGATGGACGG + Intergenic
1100107473 12:91193349-91193371 TATGGGGAGGAGGCAATGGAGGG + Intergenic
1100370850 12:93967177-93967199 TAAAGGGAGGAAGGGATGGATGG - Intergenic
1100663084 12:96721890-96721912 TATAAGGAGTAGAGGTTGGAGGG + Intronic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1101027909 12:100631561-100631583 TTTAGAGAGGAGAGGAGGGAGGG + Intergenic
1101805326 12:108058341-108058363 TATTTGTCAGAGAGGATGGAAGG - Intergenic
1102120244 12:110434650-110434672 TACTGGGAGGAGGGGTGGGAGGG + Intergenic
1102261820 12:111447633-111447655 CTGTGGGAGGAGAGGATGGTGGG - Intronic
1103102367 12:118189756-118189778 GATGGGGAGGAGGGGAAGGAAGG + Intronic
1103123369 12:118399574-118399596 TTGAGGGAGGGGAGGATGGATGG + Intronic
1105446473 13:20461900-20461922 TTGTGGGAGGAGAGGGTGGGAGG + Intronic
1105734273 13:23251537-23251559 CTTTGGGAGGCCAGGATGGAAGG + Intronic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105918714 13:24941122-24941144 AAGTAGGAGGAGAGGTTGGAAGG + Intergenic
1105986824 13:25575696-25575718 CATGGGGAGGGGAGGAGGGATGG + Intronic
1106464363 13:29999639-29999661 TATTGGGAAAGGAGGAGGGAAGG - Intergenic
1106703817 13:32259175-32259197 CATTTGGGGGAGAGGAAGGATGG + Intronic
1107061715 13:36166548-36166570 TTTCGGGAAGAGAGGATGGGGGG - Intergenic
1108778616 13:53798906-53798928 TATTGGGGGCAGAGGATGGAAGG + Intergenic
1109154882 13:58896375-58896397 GATGGGGAGGGAAGGATGGATGG + Intergenic
1109773773 13:67012709-67012731 TAGTTGGAGGAGAGGAGGGCAGG - Intronic
1110006134 13:70272655-70272677 TATTGGGAGGAGTGGACTCAAGG - Intergenic
1110293216 13:73832211-73832233 TAATGAGAGTAGAGAATGGAGGG - Intronic
1111860654 13:93700840-93700862 TACTTGGAAGAGAGGAGGGAAGG + Intronic
1112278597 13:98043536-98043558 TATTGGGAGGTTAAGGTGGAAGG - Intergenic
1112376628 13:98848321-98848343 AGTTTGGACGAGAGGATGGAAGG + Intronic
1113054330 13:106251861-106251883 TATGGGGAGGAGATGAAGAATGG - Intergenic
1113521383 13:110944144-110944166 TATGGTGAAGAGAGAATGGAAGG - Intergenic
1114365301 14:22020131-22020153 TATGGGGAGGAAATGCTGGAAGG - Intergenic
1114822065 14:26032613-26032635 TGTGGGGATGAGAGGATGGGAGG - Intergenic
1115880889 14:37916983-37917005 TATTGGGATGAGAGGGAAGAAGG + Intronic
1117180908 14:53190691-53190713 TTTTGGGAGGCAAGGTTGGAGGG - Intergenic
1117205028 14:53433367-53433389 TATTAGGAGAAGAGAAAGGAAGG - Intergenic
1117365989 14:55027528-55027550 TCCTGGGAGGAGAGCCTGGAGGG - Intronic
1117934889 14:60892233-60892255 TATTGAGAGGGGAGTATTGAAGG + Intronic
1119110220 14:71965595-71965617 TTTTGGGAAGAGAGGCTGGCTGG + Intronic
1119157888 14:72428318-72428340 TAGTTGGATCAGAGGATGGATGG + Intronic
1119535440 14:75399371-75399393 TGTCGGGAGGAGATGCTGGAAGG + Intergenic
1119768693 14:77206630-77206652 GATGGGGAGGAGAGGGTGGAGGG - Intronic
1119780780 14:77275596-77275618 TGTGGGGAGGAGAGGAAGGGAGG + Exonic
1120754018 14:88224942-88224964 TCTTGGGAAGAGAGGATTTACGG - Intronic
1121161965 14:91751801-91751823 TTTTGGAAGCACAGGATGGAGGG - Intronic
1121447591 14:93988425-93988447 AGATGGGAGGAGAGGATGGGAGG + Intergenic
1121447750 14:93988847-93988869 GGATGGGAGGAGGGGATGGAAGG + Intergenic
1121543596 14:94747149-94747171 CATTGGGAGGATGAGATGGATGG + Intergenic
1121548736 14:94782017-94782039 GATAGGGAGGAGGGGAGGGAGGG - Intergenic
1121843531 14:97154290-97154312 TAATGGGAGGAGAGGAGGAAAGG - Intergenic
1122020092 14:98830601-98830623 TACTGGGGAGAGAGGATGGTTGG - Intergenic
1122217130 14:100212035-100212057 TGTATGCAGGAGAGGATGGAAGG - Intergenic
1122408916 14:101516294-101516316 TGGTGGGAGGTGAGGGTGGAAGG - Intergenic
1122651692 14:103230072-103230094 TATGGGGAGGGGAGGAGGGGGGG + Intergenic
1122729941 14:103788966-103788988 TGCAGGGAGGAGAGGATGGTGGG + Intronic
1125334405 15:38613443-38613465 TCTTGAGAGGAGAGGGAGGAGGG + Intergenic
1126357503 15:47812004-47812026 TATTAGGAGGAGACACTGGAAGG - Intergenic
1126459254 15:48897599-48897621 TAATGGGAGGAGAGGCTGCGCGG + Intronic
1126783830 15:52160686-52160708 TATGTGGAGGAAAGGCTGGAAGG - Intronic
1127751169 15:62045737-62045759 TATTGGGAGGGAAAGAAGGAAGG + Intronic
1128228218 15:66017567-66017589 TCCTGGGAGGGGAGGAAGGACGG - Intronic
1128233359 15:66050680-66050702 TATTGGGATTAGAGAATAGATGG + Intronic
1128256260 15:66199334-66199356 GACTGGGAGGAGAGGAGGGTGGG - Intronic
1128708601 15:69855604-69855626 TAATGGGAGGAGAAGAGGGGCGG - Intergenic
1129141426 15:73601694-73601716 TAGTGGGTGGAGACGATGGTGGG - Intronic
1130658097 15:85807125-85807147 TATTGGAAGGAGAGGGTGTAGGG - Intergenic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1131273289 15:90959828-90959850 GATGGGGAGGAGAGTTTGGATGG + Intronic
1131499466 15:92947739-92947761 GTTTGGTAGGAGTGGATGGATGG + Intronic
1131946852 15:97631473-97631495 TATTGGGAGGAGAAAAAGAAGGG - Intergenic
1132567953 16:631753-631775 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132568009 16:631985-632007 GGATGGGAGGAGAGGATGGAAGG - Intronic
1132568047 16:632122-632144 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132568055 16:632148-632170 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132877298 16:2145737-2145759 GACTGGCAGGAGGGGATGGATGG - Intronic
1132976871 16:2715464-2715486 GAGTGGGTGGAGGGGATGGAGGG + Intronic
1132998157 16:2834949-2834971 TTCTGGGATGAGTGGATGGATGG + Intronic
1133501828 16:6373590-6373612 TAGTCGGATGAGAGGATGGTTGG + Intronic
1134129440 16:11639250-11639272 TAGAGGGAGGAATGGATGGATGG + Intergenic
1134767230 16:16770890-16770912 TTTTGGGCTGAGATGATGGATGG + Intergenic
1135679579 16:24444876-24444898 TTTTGGGAGGCCAAGATGGATGG + Intergenic
1136075065 16:27811613-27811635 AATTGGGAGCTGAGGATGGATGG - Intronic
1136285526 16:29238320-29238342 TAAGGGGAGGAAAGGAGGGAGGG + Intergenic
1136313227 16:29429960-29429982 TATTGAGTGAAGAGGAAGGAAGG - Intergenic
1137521745 16:49200890-49200912 TGGTGGGAGAAGAGGAGGGAGGG - Intergenic
1137709118 16:50554290-50554312 TGTTGGAAGGTGGGGATGGATGG + Intronic
1137822801 16:51461854-51461876 TATTTGAAGGAGAGCAAGGAGGG - Intergenic
1138084277 16:54119531-54119553 GGTTGGGAGCAGAGGAGGGAAGG - Exonic
1138199773 16:55080072-55080094 TATTGGGAAGGCAGCATGGATGG - Intergenic
1138750920 16:59420194-59420216 ACTTGGGAGGGGAGGCTGGAAGG - Intergenic
1138828571 16:60351387-60351409 GATGGGGAGGGGAGGATGGGGGG + Intergenic
1138951341 16:61917145-61917167 AACTGGGGAGAGAGGATGGAAGG + Intronic
1139472675 16:67186693-67186715 AGTGGGGAGGAGAGGAAGGAGGG - Intronic
1139670662 16:68490842-68490864 TATTAGGAGGAGGTGAGGGAGGG + Intergenic
1139877375 16:70157061-70157083 TATTAGGAGGAGGAGGTGGAAGG - Exonic
1140126089 16:72120091-72120113 TGTGGGAAGGAGAGGAAGGACGG + Intronic
1140204476 16:72922303-72922325 GATGGTTAGGAGAGGATGGAGGG - Intronic
1140493305 16:75360133-75360155 TTTTGGGAGGCCAGGATGGGAGG - Intronic
1140500877 16:75432785-75432807 TTCTGAGAGGAGAGGATGGGTGG + Intronic
1141014737 16:80438469-80438491 TATTAGGAGAACAGCATGGAAGG + Intergenic
1142085558 16:88178316-88178338 GACCGGGAGGAGAGGAAGGAGGG + Intergenic
1142090853 16:88208460-88208482 TAAGGGGAGGAGAGGAGGGAGGG + Intergenic
1143376132 17:6468709-6468731 GATTGGGAGGGGAGCATGGCTGG - Intronic
1143593784 17:7901934-7901956 TATTGGCAGGTGAGGGTGAAGGG + Intronic
1143724709 17:8837091-8837113 TGCTGGGAGAAGAGGCTGGAAGG - Intronic
1143949870 17:10623989-10624011 GGATGGGAGGAGGGGATGGAGGG - Intergenic
1144262630 17:13537532-13537554 GATTGGGAGGACAGAATAGAAGG - Intronic
1145066220 17:19763041-19763063 TATAGAGAGGAGAGGCTGGGGGG - Intergenic
1145107258 17:20129116-20129138 CTTTGGGAGGCCAGGATGGAAGG - Intronic
1145229840 17:21165564-21165586 TTTTGGGAGGCCAGGATGGGTGG - Intronic
1146311984 17:31776396-31776418 TAGTGTGATCAGAGGATGGAAGG - Intergenic
1146953199 17:36920818-36920840 TGTTGGGAGGTGAGGGTGGAGGG + Intergenic
1147366459 17:39962741-39962763 GATTGAGAGGAGAGGAAGGCAGG - Intergenic
1147463451 17:40591067-40591089 TATGGGGGAAAGAGGATGGATGG - Intergenic
1147863259 17:43536377-43536399 TATAGGGAGTGGAGGATGGCAGG - Intronic
1148107626 17:45127839-45127861 TCATGGGTGGAGAGGGTGGAAGG + Intronic
1148393674 17:47291555-47291577 TGGTGGGAGGGGAGGAAGGAGGG + Intronic
1148816356 17:50330743-50330765 TTTTGGGAGACTAGGATGGAAGG + Intergenic
1149007524 17:51821125-51821147 TATTGGGAGGGAGGGAGGGAGGG - Intronic
1150225179 17:63520772-63520794 GATGGGGAGGACAGGAAGGAGGG + Intronic
1150479455 17:65498098-65498120 TATTGAGGGTAGAGAATGGAAGG + Intergenic
1150645703 17:66976369-66976391 TGGAGGGAGGGGAGGATGGAGGG - Intronic
1150998568 17:70347677-70347699 TATTGGGAGGTGAGGCTTGATGG - Intergenic
1151098608 17:71529291-71529313 TATTTGGAGGTGAGGATGAAAGG - Intergenic
1151194922 17:72424627-72424649 CAGTGGGAGGAGGGGATGGCAGG - Intergenic
1151291353 17:73152575-73152597 TATTGGGAGGAAAGGAAATAGGG + Intergenic
1151432219 17:74071303-74071325 TATTTGGAGGGGCCGATGGAAGG + Intergenic
1151497696 17:74468574-74468596 TTTTGGGAGGACAAGATGGGAGG - Intronic
1152168282 17:78725078-78725100 GACTGGGAGGAGAGGTGGGATGG - Intronic
1154145181 18:11861171-11861193 TACTGAGGAGAGAGGATGGACGG - Intronic
1154246617 18:12704773-12704795 TATTGTGAGGAAAAGAAGGATGG + Intronic
1154306590 18:13234856-13234878 ATTTGGGAGGAGAGAATGGAAGG - Intronic
1155221010 18:23685841-23685863 TTTTGGGAGGTCAAGATGGATGG + Intergenic
1155749679 18:29405878-29405900 TTTGGGGAAGAGAGGTTGGAAGG + Intergenic
1156332221 18:36133005-36133027 TAATGGGAGGACAGGATGCTGGG + Intronic
1156544489 18:37950054-37950076 TATAAGGAGGGGAGGAAGGAAGG + Intergenic
1156641876 18:39111368-39111390 AATTGGGAGGAGAAGGTGGTAGG + Intergenic
1157602202 18:48901250-48901272 TAATTGGATGAGTGGATGGATGG + Intergenic
1159784617 18:72698006-72698028 TATTGGGAGAAAAGGAAGAAAGG - Intergenic
1160032126 18:75271296-75271318 TATCCGAAGGAGAGGCTGGAGGG - Intronic
1160110729 18:76027417-76027439 TATTGGGAGGTGGGGTTGGGTGG + Intergenic
1160556721 18:79730311-79730333 GGGTGGGAGGAGAGGAGGGAGGG + Intronic
1161330122 19:3682966-3682988 GAGGGGGAGGAGAGGAGGGAGGG - Intronic
1161743880 19:6042905-6042927 TTTTGGGGTGAGAAGATGGAGGG + Intronic
1161848249 19:6724707-6724729 TACTGGGAGGGAAGGAGGGAGGG + Intronic
1162875432 19:13617759-13617781 TAGTGAGAAGTGAGGATGGAAGG - Intronic
1165031101 19:32998827-32998849 TGAGGGGAGGAGAGGAAGGAGGG + Intronic
1165451169 19:35884268-35884290 TTTTGGGAGGCCAGGATGGGAGG - Intergenic
1165670937 19:37678454-37678476 AATTAGGAGGAGAGGGTGCATGG + Intronic
1165759712 19:38313811-38313833 TATTGGGAGGTGCTGATGGAGGG - Intronic
1166088141 19:40490317-40490339 TATTGGAAGGAAAGAATGAATGG - Intronic
1166330829 19:42077051-42077073 TATTGGAAGGGGAGGAAGTAGGG + Intronic
1166715224 19:44962684-44962706 TTTTGGGAGGCCAGGTTGGAAGG + Intronic
1167433974 19:49468580-49468602 TACGGGGAGGAGAGGCAGGAAGG - Intronic
1167465302 19:49647521-49647543 TATTTGGAGGAGGGGTTGGAGGG + Intronic
925853341 2:8105617-8105639 GAATAGGAGGAAAGGATGGAAGG - Intergenic
925965596 2:9062552-9062574 TATTGTTCTGAGAGGATGGAGGG - Intergenic
926761902 2:16285467-16285489 GCCTGGGAGGAGAGGGTGGAGGG + Intergenic
926999939 2:18783989-18784011 TATTGGGAGGACACGAGGAATGG + Intergenic
927886418 2:26721391-26721413 TTGGGGGAGGAGAGGAGGGAGGG - Intronic
928388365 2:30888911-30888933 AATTGGGAGGTGGGGGTGGAGGG - Intergenic
929819670 2:45262939-45262961 GACTGGGAGGAGAAGATGGACGG - Intergenic
930226537 2:48799915-48799937 TTTTGGGAGGAGAGGGAGGCTGG + Intergenic
931642897 2:64396955-64396977 GATGGTGAGGAGAGGATTGAGGG - Intergenic
932796855 2:74703497-74703519 TAACGGGAGGGGAGGAAGGATGG - Intergenic
932851010 2:75186877-75186899 TATTGGGAGGAGATGAAGCAAGG + Intronic
932911496 2:75810650-75810672 GGTGGGGAGGAGAGGAGGGAGGG - Intergenic
934120039 2:88829488-88829510 TGTTGGGAGAAGAGAAGGGAAGG + Intergenic
935942351 2:108254054-108254076 TACAGGGAGGAGGGGTTGGAGGG - Intronic
936282313 2:111152750-111152772 CATTGGGAGAAGAGGAGGGGAGG - Intronic
936744850 2:115562549-115562571 TAATAGGAGGAGATGATAGAGGG - Intronic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937814035 2:126231569-126231591 AACAGGAAGGAGAGGATGGAGGG - Intergenic
937818057 2:126275542-126275564 TCAGGGGAGGAGAGGAGGGATGG - Intergenic
938323388 2:130380727-130380749 AAGTGGGAGGCGAGGAAGGAGGG + Intergenic
938737611 2:134200773-134200795 TCTTGGGAGGCCAAGATGGAAGG + Intronic
939043695 2:137223780-137223802 TATTGGGAGGAGGGGCCTGATGG + Intronic
939351018 2:141037369-141037391 AATAGGAAGGAGAGGATGGAGGG + Intronic
939465700 2:142553119-142553141 TATTTGGAGGAGAGAATGTTGGG - Intergenic
939700889 2:145389108-145389130 TATTGGGAGTGGAGGGTGGGAGG - Intergenic
940801009 2:158132337-158132359 TCAGGGGAGGAGTGGATGGAAGG + Intronic
940838820 2:158555622-158555644 TATTTGGATGTGAAGATGGATGG + Intronic
941001140 2:160204941-160204963 TAATGGGAGGTGAGGCTGGCAGG + Intronic
942266633 2:174234046-174234068 AAGTGGAAGGAGAGGAAGGAGGG - Intronic
942551805 2:177127681-177127703 TTTTGGGAGGCTAGGATGGGAGG - Intergenic
942728179 2:179033568-179033590 GACTGGGAGTAGGGGATGGATGG + Intronic
943657563 2:190525829-190525851 TATTGGTAAGGGAGCATGGATGG + Intronic
943675882 2:190716185-190716207 TATTTGGAGGTGAGCATGGAGGG - Intergenic
944053016 2:195492756-195492778 TACTAGGAAAAGAGGATGGATGG + Intergenic
946034605 2:216731785-216731807 AGTTTGGAGGAGATGATGGAAGG - Intergenic
946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG + Intronic
946299662 2:218814808-218814830 TCCTGGGAGGAGAGGAAGGGAGG + Intronic
946406283 2:219493643-219493665 TATTGGGAGGGATGGCTGGAGGG + Intronic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946765422 2:223036005-223036027 TATTTGGAGGAGAAGCTGGAGGG - Intergenic
947679832 2:232020386-232020408 GATGGAGAGGAGTGGATGGATGG + Intronic
948088242 2:235268138-235268160 GGATGGGAGGAGAGGAGGGATGG - Intergenic
948125248 2:235560347-235560369 CATGGGGAGGTGAGGAGGGAGGG - Intronic
1168973168 20:1944890-1944912 TAGAGGGATGGGAGGATGGACGG + Intergenic
1169196698 20:3686991-3687013 TATTGGGAGGACATTCTGGACGG + Exonic
1169406779 20:5327769-5327791 AATGGTGAGGAGAGGAGGGAAGG - Intergenic
1169543895 20:6631022-6631044 AATTAGGAGTAGGGGATGGAGGG - Intergenic
1169772781 20:9219646-9219668 TATTTTTAGGAGAGGATGGAGGG - Intronic
1170744937 20:19090960-19090982 TTTAGGGAGGAGAGAAGGGAAGG + Intergenic
1172278588 20:33694667-33694689 GCTTGGGAGGAGAGAATGGGAGG - Intergenic
1172618231 20:36303994-36304016 TATGGGGAGGAGGGGAAGGAAGG - Intergenic
1172862146 20:38062941-38062963 TTTTGGGAGGCCAGGATGGGAGG - Intronic
1173326572 20:42038866-42038888 TACTGGGTGGAGAGGAGAGAGGG + Intergenic
1173739287 20:45385677-45385699 GATTGGGGTGAGAGGAAGGAGGG - Intronic
1173801699 20:45898315-45898337 TATGGGGAGGAGGGAATGGTGGG + Intronic
1174083409 20:47987154-47987176 CATTAGGAGTAGAGGAAGGAAGG - Intergenic
1174553983 20:51381024-51381046 TACTGGGAGGTGAGGTAGGAAGG + Intergenic
1174568035 20:51481075-51481097 TTGTAGGAGGGGAGGATGGAGGG - Intronic
1175016582 20:55797625-55797647 AATTGGGAGTAGAGATTGGAAGG - Intergenic
1175973998 20:62701381-62701403 TGGTGGGGGGAGAGGAAGGAGGG - Intergenic
1175981820 20:62742584-62742606 TCTGGGGAGCAGAGGACGGAAGG - Intronic
1176287491 21:5026024-5026046 CATGGGGAGGAGCGGCTGGATGG - Intronic
1177055630 21:16297871-16297893 TATTAGGAGAACAGGATGGGGGG - Intergenic
1177195946 21:17903613-17903635 TATTGGGAGGTGGGGGTGGGAGG + Intronic
1177638574 21:23817181-23817203 TGGAGGGAGGAGAGGATGGGAGG - Intergenic
1177963453 21:27698126-27698148 TATTAGCAGGAGAGGAGTGAGGG + Intergenic
1178049934 21:28736226-28736248 TATTAGGATGAGAATATGGAAGG + Intergenic
1178963238 21:37087930-37087952 TATTGCTATGACAGGATGGATGG - Intronic
1179064720 21:38014445-38014467 TCTTGGGAAGGGAGGTTGGAGGG + Intronic
1179199696 21:39205228-39205250 TATTGGGAGGCCAAGGTGGAAGG + Intronic
1179869690 21:44237451-44237473 CATGGGGAGGAGCGGCTGGATGG + Intronic
1181461591 22:23089078-23089100 TCCTGGGAGGTGAGGAGGGAGGG + Intronic
1181824899 22:25507180-25507202 TATATGGAGGGGTGGATGGATGG - Intergenic
1181877262 22:25949347-25949369 GATGAGGAGGAGTGGATGGATGG + Intronic
1182422149 22:30253868-30253890 CACTGGGTGGGGAGGATGGAGGG + Intergenic
1182441254 22:30365655-30365677 CTTTGGGAGGAAAGGATGGTAGG + Intronic
1182587340 22:31352080-31352102 TGATGGGAGGAGGAGATGGAGGG + Intergenic
1183328425 22:37206713-37206735 GATGGGGAGGAGAGCAGGGAGGG - Exonic
1183688573 22:39375759-39375781 CAGTGAGAGGGGAGGATGGAGGG - Intronic
1184835711 22:47019829-47019851 AAGAGAGAGGAGAGGATGGAGGG - Intronic
1184835722 22:47019880-47019902 AAGGGAGAGGAGAGGATGGAGGG - Intronic
1185046644 22:48531783-48531805 TCCTGGGAGGAGAGGCTGGGAGG + Intronic
1185142401 22:49109898-49109920 CACTGGGTGGCGAGGATGGAGGG + Intergenic
1185212877 22:49581733-49581755 TAGATGGAGGAAAGGATGGATGG - Intronic
1185212901 22:49581841-49581863 TAGATGGAGGAAAGGATGGATGG - Intronic
949605183 3:5645147-5645169 TAGAGGGAGGTGAGGATGGCAGG + Intergenic
949657006 3:6232421-6232443 TATTGGGAGGCCATGGTGGATGG - Intergenic
949758750 3:7444697-7444719 TGTTGGGAGCAGGGGGTGGATGG - Intronic
950196890 3:11015637-11015659 GAAGGGGAGGAGAGGAGGGATGG - Intronic
950458295 3:13105613-13105635 TACAGAGAGGAGGGGATGGAGGG - Intergenic
950474209 3:13205547-13205569 TAGAGGGAGGGAAGGATGGATGG - Intergenic
953633004 3:44635844-44635866 CAGTGGGAGGAGGAGATGGATGG + Intronic
954284326 3:49608000-49608022 GAATGGGAGGAGGGTATGGAGGG + Intronic
954930056 3:54273398-54273420 GAATGGGATCAGAGGATGGAGGG - Intronic
955641190 3:61086911-61086933 GAGTGGTAGGAGATGATGGAGGG - Intronic
956397078 3:68837447-68837469 TATTGGCTGGAGTGGAAGGAAGG - Intronic
957952732 3:87146006-87146028 TATTGGGTGGAAAGGAAGAAAGG - Intergenic
958800328 3:98747880-98747902 TACTGGGAGGAGAGGAATGGGGG + Intronic
959374411 3:105570927-105570949 TGCTGGGAGGAAAGGAAGGAAGG + Intronic
959382735 3:105661044-105661066 TTTTGGGAGGCCAAGATGGAAGG - Intronic
959460288 3:106617062-106617084 GATTTGGGGGAGAGGAGGGAGGG + Intergenic
960052593 3:113252504-113252526 TCCTGGGAGGAGAGTAGGGAGGG + Intronic
960350324 3:116585236-116585258 TAATGGAAGGAGAGGGTGCAAGG + Intronic
961387252 3:126529746-126529768 TGATGGGAGGGGAGGAGGGATGG - Intronic
962025200 3:131540527-131540549 TATGGGGGTGGGAGGATGGATGG + Intronic
962352121 3:134663908-134663930 TGTAGGGAGGACAGGATGGCAGG - Intronic
962357267 3:134705474-134705496 TATTGGGAGGTGAGGCCTGATGG - Intronic
963785770 3:149533007-149533029 TAGAGGGAGCAGAGGAAGGAAGG - Intronic
964209553 3:154211955-154211977 TAAAGGGAGGAGAGTTTGGAAGG + Intronic
964646175 3:158960455-158960477 TAATGGGAGGTGAGGAAGGGAGG - Intergenic
964884791 3:161469346-161469368 TCCTGGAAGGAGAGGATTGAAGG + Intergenic
965701501 3:171463154-171463176 TTTTGGGAGGACAGGTTGGGAGG + Intergenic
966129119 3:176616613-176616635 CATTGGGAGGCCAAGATGGAAGG - Intergenic
966399526 3:179534445-179534467 AATTGGGAGGAGAGTGTGGAAGG + Intergenic
966942344 3:184754914-184754936 TATTGGGAGAAGAAGGTGGTGGG + Intergenic
967083322 3:186070889-186070911 TAATGGTGGGAGTGGATGGAAGG - Intronic
967162401 3:186750561-186750583 TTTTGGGAGGACAAGGTGGAAGG + Intergenic
968212396 3:196859935-196859957 TATTGGGAGAACAGCATGGGGGG + Intergenic
969576320 4:8038140-8038162 TTTTGCGAGCAGATGATGGAGGG - Intronic
970504499 4:16713716-16713738 TAGTGGGACAAGAGGAGGGATGG + Intronic
971303706 4:25462696-25462718 TATTTGGAGGAGAGGTTGTGGGG - Intergenic
971409000 4:26350623-26350645 CATTAAGAGGTGAGGATGGAGGG + Intronic
972271424 4:37513831-37513853 TGTAGGGAGTAAAGGATGGAGGG + Intronic
972606559 4:40619183-40619205 TTTTGGGAGGCCAAGATGGATGG + Intronic
973028582 4:45306096-45306118 TATTGTAAGGAGAAGATTGAAGG + Intergenic
973168079 4:47102700-47102722 TGTTGAGAGATGAGGATGGAAGG + Intronic
973553456 4:52058298-52058320 TTTTGGGAGGAGAGATTAGATGG + Intronic
974718160 4:65698665-65698687 GAATAGGAGGAGAGGAAGGAAGG - Intergenic
976057520 4:81085561-81085583 GATTAGGAGGAGAGAATGGAAGG - Intergenic
976075530 4:81295172-81295194 TATTAGATGGATAGGATGGATGG + Intergenic
976327636 4:83790646-83790668 TATTGGAATGAGAGAATTGAAGG - Intergenic
977574214 4:98659210-98659232 AAGTGGGAGGAAAGGATGAAGGG + Intergenic
977609437 4:99017011-99017033 AATTTGGGGGAGAGGAGGGAGGG + Intronic
978804902 4:112789570-112789592 TATGGGGAGGAGAAGATATAAGG + Intergenic
979189689 4:117840975-117840997 TGTTTGGAGGAGGGGATGGTCGG - Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979582521 4:122377720-122377742 TATTGGGGAAAGTGGATGGAAGG + Intergenic
980470964 4:133250935-133250957 GATGGAGAGGAAAGGATGGAGGG + Intergenic
980518723 4:133902020-133902042 TATTGAGAGGAAAAGATTGAAGG - Intergenic
981330518 4:143503328-143503350 AGTAGGGATGAGAGGATGGAGGG - Intergenic
981647481 4:147017149-147017171 GATTGGGAGCAGAGGCTGAAAGG + Intergenic
982672104 4:158333363-158333385 CATGGGTAGGAGATGATGGAAGG - Intronic
982761908 4:159294710-159294732 GAGTGAGAGGAAAGGATGGAAGG - Intronic
983410194 4:167386426-167386448 TTTTGGGAGGACAAGATGGGAGG - Intergenic
985485549 5:146397-146419 CATAGTGGGGAGAGGATGGAGGG - Intronic
985958064 5:3279049-3279071 GAATGGGAGGAGAGGAAGGAGGG - Intergenic
986694699 5:10341110-10341132 TATTGCCAGGAGAAGAAGGAAGG + Intergenic
987320930 5:16768782-16768804 GCTTGGGAGGAGAGGGTGGGAGG - Intronic
987690939 5:21265903-21265925 TATTGAGAGAAAAGGAGGGAGGG + Intergenic
987711915 5:21511600-21511622 TAGTGGGAGCTGAGGATGGGTGG - Intergenic
988302495 5:29449183-29449205 TAGTGGGAGCTGAGGATGGGTGG + Intergenic
988408472 5:30855272-30855294 TATTGAGAGTAGAGGATTGTGGG - Intergenic
988487709 5:31680438-31680460 TAATGAGAGGTGAGGATGGCTGG + Intronic
988675361 5:33427854-33427876 CTATGGGAGGGGAGGATGGATGG + Intergenic
990429868 5:55724172-55724194 GATTGGGAGGAGAGGTTGAGAGG + Intronic
990480653 5:56207089-56207111 GAAGGGGAGGAGAGGATAGAAGG - Intronic
990626130 5:57613336-57613358 AGTTTGGAGGAAAGGATGGAAGG + Intergenic
990781469 5:59369448-59369470 TATTTGGAGAAGAGGCAGGAAGG + Intronic
990887251 5:60608863-60608885 TTTTGGGAGGCCAAGATGGAAGG + Intronic
991762275 5:69930739-69930761 TAGTGGGAGCTGAGGATGGGTGG - Intergenic
991785052 5:70187366-70187388 TAGTGGGAGCTGAGGATGGGTGG + Intergenic
991841503 5:70805788-70805810 TAGTGGGAGCTGAGGATGGGTGG - Intergenic
991877499 5:71187758-71187780 TAGTGGGAGCTGAGGATGGGTGG + Intergenic
991960086 5:72035709-72035731 TGTCAGAAGGAGAGGATGGAGGG - Intergenic
991985764 5:72285106-72285128 TGTTGGCAGGAGAGAAGGGAGGG - Intronic
992508800 5:77413488-77413510 TATTTGGAGGAGGGGAGGGCTGG - Intronic
992562139 5:77963416-77963438 TACTGGGAGCAGATGATGGCAGG - Intergenic
992645579 5:78808226-78808248 TATGGGGAGGAGGGGGTGGGAGG - Intronic
993007281 5:82442209-82442231 TATTGGGAGGGGAGATGGGAAGG + Intergenic
994658224 5:102620866-102620888 AAGTGGTAGGAAAGGATGGAGGG - Intergenic
995333043 5:110966874-110966896 TGTTGGGCAGAGAGCATGGATGG - Intergenic
996769288 5:127068958-127068980 TCTTTGGAGTTGAGGATGGAGGG - Intronic
997499144 5:134357748-134357770 AATGGGAAGGAGAGGAAGGATGG - Intronic
999811814 5:155134684-155134706 TGTTGGGAGGAGTTGAAGGAGGG - Intergenic
1000380820 5:160627910-160627932 TGGTGGGAAGAGAGGAGGGAGGG + Intronic
1002625604 5:180526332-180526354 TAATGTGATGAGAGGAAGGAAGG + Intronic
1002791436 6:440688-440710 GATGGGTGGGAGAGGATGGAAGG - Intergenic
1003478952 6:6513333-6513355 TATGGGCAGGAGAGAAGGGAGGG - Intergenic
1004262648 6:14121534-14121556 TTTTGGGAGGCGAAGATGGGAGG + Intronic
1004723475 6:18289401-18289423 GATTGGGAGGAGGGGCTAGATGG + Intergenic
1004990893 6:21137090-21137112 TATTGGGAGGAGAAGGGGGTTGG + Intronic
1005021223 6:21420868-21420890 TAGGGTGAGGAGAGGAGGGAAGG + Intergenic
1005277642 6:24237208-24237230 AATTGAGAGCAGAGGGTGGAAGG + Intronic
1005354904 6:24973047-24973069 TAATGAAAGGAGAGGAAGGAAGG + Intronic
1005530836 6:26704063-26704085 TATTGGGTGGAGAGATTTGAGGG - Intergenic
1005539960 6:26797583-26797605 TATTGGGTGGAGAGATTTGAGGG + Intergenic
1006304399 6:33210355-33210377 CTTTGGGAGGTGAGGATGGGAGG + Intronic
1006902299 6:37511039-37511061 GACTGGAAGGAGGGGATGGAGGG - Intergenic
1006931912 6:37693782-37693804 GATTGGGAGGCGAGGAGGGAGGG + Intronic
1007425753 6:41744841-41744863 GAGTGGGAAGAGAGGAAGGAGGG - Intronic
1007459923 6:42010431-42010453 AGTTGGAAGGAGAGGAGGGAGGG + Intronic
1007717887 6:43867816-43867838 CATTGGGAGAAAAGGAGGGAGGG - Intergenic
1008208644 6:48694083-48694105 GATTGGGAAGAGATGAGGGAAGG + Intergenic
1008837969 6:55860782-55860804 TATTGGGAGCTGAGGATAGCCGG + Intronic
1009005789 6:57785088-57785110 TAGTGGGAGCTGAGGATGGGTGG + Intergenic
1009828481 6:68898243-68898265 TAAGGGCAGGAGAAGATGGATGG + Intronic
1010189152 6:73176685-73176707 TACTGATTGGAGAGGATGGAGGG + Intronic
1010211011 6:73363025-73363047 TCTTGGGAGGGGAAGGTGGAAGG - Intronic
1010383668 6:75253105-75253127 TATTTTGAGGGGAGGGTGGAGGG - Exonic
1010418270 6:75641102-75641124 GTAGGGGAGGAGAGGATGGAGGG - Intronic
1010732117 6:79402298-79402320 CATTGGGAGAAGAGGAAGAAAGG + Intergenic
1011185725 6:84673529-84673551 TTTTGGGAGGAGAAGGTGGGTGG + Intergenic
1011342406 6:86331428-86331450 TATTAGGAGGGGAGGAAAGAGGG + Intergenic
1011944939 6:92889363-92889385 TAATGGGAGGCTAAGATGGAAGG - Intergenic
1012242411 6:96888540-96888562 TAGGGTGAGGAGAGGAAGGAAGG - Intergenic
1012628681 6:101435461-101435483 TATTTGGAGGAGGGGATTGAGGG - Intronic
1012691273 6:102314557-102314579 TACTGGGTGGGGAGGGTGGAAGG + Intergenic
1012840004 6:104318117-104318139 AATCTGGAGGAGAGGAGGGAAGG - Intergenic
1013802936 6:113968366-113968388 TATTGTGAGAAGAGAATGCAAGG - Intronic
1013837115 6:114345707-114345729 ATTTGGGAGGAGAAGGTGGAAGG + Intergenic
1014402938 6:121013661-121013683 TTTTGGGAGGCCAAGATGGAAGG + Intergenic
1014588248 6:123228565-123228587 TATTGTGAGAATAGCATGGAGGG + Intronic
1015638850 6:135308477-135308499 TTTTGGGAGGCCAGGGTGGATGG - Intronic
1015982950 6:138857441-138857463 GTGTGGGAGGTGAGGATGGAGGG - Intronic
1016735753 6:147478019-147478041 TCTTGGCAGGAGATGATGAAAGG + Intergenic
1017065038 6:150520623-150520645 GATTGGGAGGAGAGGGTGCCAGG - Intergenic
1017427244 6:154335067-154335089 TTTTGGGAGGCCAGGATGGGAGG + Intronic
1018088698 6:160327169-160327191 AAATGGGAGGAAAAGATGGAGGG - Intergenic
1018742246 6:166738855-166738877 CATTGGCAGGAAATGATGGATGG - Intronic
1019411925 7:910491-910513 TGGTGGGAGGAGAGGCAGGAGGG - Intronic
1019551788 7:1606800-1606822 GAGTGGGAGGGGAGGAGGGAGGG - Intergenic
1019599638 7:1874825-1874847 TATAGGGAGGAGGGGAAGGCAGG + Intronic
1019848170 7:3527640-3527662 TGGTGGGAGGTGAGGTTGGAGGG + Intronic
1020376841 7:7497016-7497038 TTTTGGAAAGAGAGGAAGGAAGG + Intronic
1020458494 7:8401674-8401696 AAATGGGAGGAGGGGATGAAAGG - Intergenic
1020822181 7:12983913-12983935 TGCTTGGAGGAGAGGATGGAGGG + Intergenic
1021439390 7:20660858-20660880 AATGGAGAGGAGGGGATGGAAGG - Intronic
1021878301 7:25069285-25069307 AAATGGGAGGAGAGGATGTGGGG + Intergenic
1022044097 7:26609692-26609714 GATCCGGAGGACAGGATGGATGG + Intergenic
1022887666 7:34663102-34663124 GAGTGGGGGTAGAGGATGGATGG + Intronic
1024221885 7:47295358-47295380 TATTGGGAGAGGAGGAATGATGG - Intronic
1024242299 7:47445022-47445044 TATTGGGAAGAGGGGCAGGAAGG + Intronic
1024788154 7:52931906-52931928 TTTTGGGAGGAGGTGACGGAAGG - Intergenic
1025985645 7:66449010-66449032 CTTTGGGAGGACACGATGGATGG - Intergenic
1026250673 7:68667462-68667484 TTTTGGGAGGACAAGATGGGTGG - Intergenic
1026534707 7:71230065-71230087 TATAGGGGTGAGAGGATGGAGGG + Intronic
1027343902 7:77237967-77237989 AATTGCGGGGAGAGGATGGCTGG - Intronic
1028032971 7:85941223-85941245 TAATGGGAGGAGAGGCAGAAAGG - Intergenic
1028150249 7:87364034-87364056 TATTGGGAGGAGATGATTTAGGG + Intronic
1028314666 7:89385228-89385250 TATTGGGAAGAGAATCTGGAAGG - Intergenic
1028682420 7:93551685-93551707 TCCTGGATGGAGAGGATGGAAGG + Intronic
1028804093 7:95004345-95004367 TATTGGAAGGAGAGGAAGAGAGG + Intronic
1028972882 7:96878079-96878101 CTTTGGGAGGCCAGGATGGATGG - Intergenic
1029515862 7:101022579-101022601 TATTGGGAGGCCAAGTTGGAAGG + Intronic
1029622445 7:101698625-101698647 TACTGGGAGGAGTGGGTGGGTGG - Intergenic
1030057124 7:105592967-105592989 TATTGGGAGGCGAAGGTGGGTGG - Intronic
1030579602 7:111337439-111337461 TATTTGGATGGAAGGATGGATGG + Intronic
1031011302 7:116526880-116526902 TATTGGGGGGAGATGGGGGAAGG - Intronic
1031019374 7:116610476-116610498 AATGGGGAGGAGATGATTGATGG - Intergenic
1031361542 7:120854844-120854866 TATTGGGAGAAGAGGAGGGCTGG + Intronic
1031816352 7:126442152-126442174 GATAGGGAGGAAAGGAGGGAGGG - Intronic
1032403895 7:131642150-131642172 TAGTGGTAGGAGTGGAGGGAAGG + Intergenic
1032464835 7:132137685-132137707 GAATGGGAGGGGAGGATGGGTGG + Intronic
1033759668 7:144425044-144425066 TATTGGGAATAGAGGATGAAGGG - Intergenic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034457924 7:151181460-151181482 TATTGGGGGGAGACGGTGGTGGG + Intronic
1034488049 7:151378560-151378582 TTTTGTGAGGAGATGATGGAAGG + Intronic
1034504588 7:151477664-151477686 TTCTGGGAGAAGAGGATGGATGG + Intronic
1034718047 7:153261941-153261963 AATTGGAAACAGAGGATGGAAGG + Intergenic
1034725841 7:153334384-153334406 TTTTGGGAGGAGAGGCAGGGAGG - Intergenic
1034864830 7:154632296-154632318 TCTTTGTAGGAGAGGAAGGATGG + Intronic
1035599979 8:891627-891649 TTCTGGGAGTAGAGGATGGGTGG + Intergenic
1035600919 8:896301-896323 GGTTTGGAGGAGAGGATGTAGGG + Intergenic
1035971931 8:4258457-4258479 GAGAGGGAGGGGAGGATGGAAGG + Intronic
1036025387 8:4902164-4902186 TTTTGGGAGAACAAGATGGAAGG + Intronic
1036789334 8:11707991-11708013 TATTGGGGGCAGAAGACGGAGGG - Exonic
1037127509 8:15368956-15368978 AAGTAGGAAGAGAGGATGGAAGG + Intergenic
1037188486 8:16093421-16093443 TAATGAGTGGAGAGGCTGGAAGG - Intergenic
1038493961 8:27988900-27988922 GGCTGGGAGGAGAGGATGCAGGG + Intronic
1039020930 8:33205533-33205555 TATGGGGAGGAGAAAATGAATGG - Intergenic
1039058288 8:33553927-33553949 TATTGTGGGGAGAGGTGGGAGGG - Intronic
1039526496 8:38220951-38220973 TATTGGGAGGCCAGGATGGGAGG - Intergenic
1039784812 8:40824931-40824953 TATTGGGAGCAGAGGATGAGAGG - Intronic
1040392179 8:46959656-46959678 ATTTGGGGGGAGAGGAGGGAAGG + Intergenic
1041178276 8:55220741-55220763 TACTGGGGGAAGAGAATGGAGGG - Intronic
1041541573 8:58990808-58990830 TTGTGGGAGCAGAAGATGGAAGG - Intronic
1041642905 8:60221699-60221721 TATGGGGAGGAGAGGCTGAGTGG + Intronic
1041748951 8:61238246-61238268 TAGAGGGAGGAAAGGAAGGAAGG - Intronic
1042046873 8:64663136-64663158 TCTAGCAAGGAGAGGATGGAGGG - Intronic
1045383301 8:101647873-101647895 GATTGGGAGGAGGGGGAGGAGGG + Intronic
1045839982 8:106568412-106568434 TATTGGGAGGAGAGGATGGAAGG - Intronic
1046347074 8:112944153-112944175 TATAAGGAGATGAGGATGGATGG - Intronic
1046632196 8:116632256-116632278 TATATTGAGGAGAGCATGGAAGG - Intergenic
1046834123 8:118780259-118780281 AATTGGGTGGAGAGAATGAATGG + Intergenic
1048224606 8:132572968-132572990 TTGTGGGAGGAGAGGTTGGTGGG - Intronic
1048785069 8:138041859-138041881 TATTGAGATGTGAGCATGGAGGG - Intergenic
1048930356 8:139310338-139310360 TATTGGGTGGGGAAGATGGATGG - Intergenic
1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG + Exonic
1051086110 9:13350604-13350626 TAATGGAAGGAGAGGATGATTGG + Intergenic
1051231286 9:14958075-14958097 GATAGGGAGGACAGGGTGGAGGG + Intergenic
1051348584 9:16175723-16175745 CATTGGCAGAAGAGGATGGATGG + Intergenic
1052057868 9:23923814-23923836 TATAGGGAGGATAGGATACAGGG + Intergenic
1052317102 9:27126793-27126815 GATTGGGGCCAGAGGATGGAAGG + Intronic
1053149958 9:35737038-35737060 AATTGGGTGGAGAGAAGGGAAGG + Exonic
1053180601 9:35965263-35965285 TATTGGGTGGAGATGAAGGGAGG - Intergenic
1053853093 9:42309583-42309605 GATGGTGAGGAGAGGATAGATGG + Intergenic
1055428832 9:76223123-76223145 GATTGGTAAGAGAGGATGGGAGG - Intronic
1055453360 9:76451254-76451276 TATTGCAAGAAGAGGATGGGTGG + Intronic
1055562749 9:77537214-77537236 GGTTGGGAGGGGAGGATGAAGGG - Intronic
1055930585 9:81555926-81555948 TAGAAGGAGGAGAGGAAGGAGGG - Intergenic
1056097217 9:83267299-83267321 CATTGGGAGGGGAGGAGGGAGGG + Intronic
1057602971 9:96474976-96474998 TAATGAAAGGAGAAGATGGAAGG - Intronic
1057723683 9:97553718-97553740 ATTTGGGAAGAGAGGATAGAGGG + Intronic
1058578805 9:106432306-106432328 TATTGAATGGAAAGGATGGATGG + Intergenic
1058909028 9:109504295-109504317 TCTTGGGACTAGAGGATGAAGGG - Intergenic
1060210060 9:121704700-121704722 TATGGAGAGGAGAGGACGGGAGG - Intronic
1060290153 9:122294902-122294924 TTTTAGGAGAAAAGGATGGAGGG + Intronic
1061364679 9:130165757-130165779 TTTTGGGAGGACAAGGTGGAGGG + Intergenic
1061431676 9:130535339-130535361 TATTTGGAAGGGTGGATGGACGG + Intergenic
1061432156 9:130537821-130537843 TGCAGGGAGGAGAGGATTGAGGG - Intergenic
1061548044 9:131316010-131316032 TTCTGGGAAGAGAGGACGGAGGG + Intergenic
1061650454 9:132044136-132044158 AATAGGGAGGGGAGGAGGGAAGG + Intronic
1062026601 9:134343513-134343535 TTTTGGGAGGAGTGGTTGCAGGG + Intronic
1062406131 9:136397556-136397578 TGTTGGGAGGAGAGGCTGTGGGG + Intronic
1186145085 X:6616685-6616707 TAATGGGAGGAGAGCAGAGATGG + Intergenic
1186506645 X:10098879-10098901 TATTGGAAGGAGGGAAGGGAAGG - Intronic
1186546075 X:10451182-10451204 CATAAGCAGGAGAGGATGGACGG - Intronic
1186731507 X:12415375-12415397 ACTGGGGAGGAGAGGATGGATGG - Intronic
1187296547 X:18007091-18007113 TCGTAGGAAGAGAGGATGGAAGG + Intergenic
1187772382 X:22714558-22714580 TATTGGGACAATAGGAAGGAAGG + Intergenic
1188034222 X:25298538-25298560 TATTGGGAAGAGAAGAGGCAAGG - Intergenic
1188822683 X:34794840-34794862 TAATAGGAGGATGGGATGGAGGG - Intergenic
1189145296 X:38649504-38649526 TTTTGGGAGGAGCTGAGGGAAGG + Intronic
1189219482 X:39358916-39358938 TAGAGGAAGGTGAGGATGGAAGG - Intergenic
1190427193 X:50345011-50345033 TTTGGGGAGGAGAGGAAGGCAGG - Intronic
1190443915 X:50503905-50503927 TTCTGGGAGGAGAAGATGGAAGG + Intergenic
1192419993 X:71021088-71021110 TGTTAGGAGTGGAGGATGGAAGG - Intergenic
1192626977 X:72739040-72739062 TAAAGGGAGGAGGGAATGGAGGG - Intergenic
1192707240 X:73539348-73539370 TGTTGGGAGGCCAAGATGGAAGG + Intergenic
1194072532 X:89344675-89344697 TACTGGGAAGAGAGGGTGGCTGG - Intergenic
1195691329 X:107628337-107628359 TATTGGGTGAAGAGCATGAACGG - Intergenic
1195917733 X:109952360-109952382 TTTGGGCAGGAGAGGAAGGAGGG - Intergenic
1196040261 X:111195208-111195230 TAATGAGAGGAGAGCAAGGAAGG - Intronic
1196340097 X:114585004-114585026 GAGTGGGAGGAGAGAAAGGAGGG + Intronic
1197170017 X:123422452-123422474 TATTAGGAGGAGTCGGTGGAAGG + Intronic
1197738499 X:129871041-129871063 TATTAGAAGGGGTGGATGGAAGG - Intergenic
1199582299 X:149372524-149372546 AATAGGGAGGAGAGGCTGAAAGG + Intergenic
1200015966 X:153164115-153164137 TGGTGGGAAGAGAGGAAGGAGGG - Intergenic
1200223139 X:154401916-154401938 TCTTTGGAGAGGAGGATGGAAGG + Exonic
1200726770 Y:6680422-6680444 TACTGGGAAGAGAGGGTGGCTGG - Intergenic
1200727922 Y:6696198-6696220 TACTGGGAAGAGAGGGTGGCTGG - Intergenic
1201322788 Y:12718731-12718753 TTTTGGGAGGTGAAGATGGGAGG - Intronic
1201514160 Y:14799179-14799201 TATGGAGAAGAGAAGATGGAAGG + Intronic
1201625630 Y:16011858-16011880 GAGTGGGAAGAGAGGAAGGAAGG + Intergenic
1202382683 Y:24290372-24290394 TACTGGGAGGAGGGCATGAAGGG + Intergenic
1202488101 Y:25379752-25379774 TACTGGGAGGAGGGCATGAAGGG - Intergenic