ID: 1045841002

View in Genome Browser
Species Human (GRCh38)
Location 8:106580961-106580983
Sequence TGCTTGTTTCCTCATTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045840999_1045841002 30 Left 1045840999 8:106580908-106580930 CCTGAACATTCCTTAAGTAAATG 0: 1
1: 0
2: 1
3: 14
4: 202
Right 1045841002 8:106580961-106580983 TGCTTGTTTCCTCATTCTTGTGG 0: 1
1: 0
2: 0
3: 32
4: 284
1045841000_1045841002 20 Left 1045841000 8:106580918-106580940 CCTTAAGTAAATGAATGACTTGC 0: 1
1: 0
2: 1
3: 14
4: 191
Right 1045841002 8:106580961-106580983 TGCTTGTTTCCTCATTCTTGTGG 0: 1
1: 0
2: 0
3: 32
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045841002 Original CRISPR TGCTTGTTTCCTCATTCTTG TGG Intronic
902997637 1:20239162-20239184 GGCTTGTTTCATCAGTCTTAAGG - Intergenic
903689496 1:25162191-25162213 GGCTTGTTTTCTCATTCTCTTGG - Intergenic
903729293 1:25478867-25478889 TCCTTCTTGCCTAATTCTTGTGG - Intronic
905961204 1:42044137-42044159 TGCTTGTCTCTTCATTATTGGGG - Intergenic
909249175 1:73329242-73329264 TTTTAGTTTCCTTATTCTTGAGG + Intergenic
909575039 1:77165192-77165214 TGTTTGTTTCCTGATTCTGTTGG - Intronic
909580778 1:77231944-77231966 TGCTTCTTTCCTGCTTCTTGTGG - Intergenic
910350712 1:86294364-86294386 TGCTTGTTTCCTGTCTCTTGGGG + Intergenic
912348965 1:108993098-108993120 TGGTTGATTCCTCATTCTTTGGG - Intronic
912506043 1:110156998-110157020 CCCTTCTTTCCTCATTCATGGGG - Intronic
913976386 1:143460389-143460411 TGTAGGTTTCCTCATTTTTGGGG - Intergenic
914070786 1:144286004-144286026 TGTAGGTTTCCTCATTTTTGGGG - Intergenic
914087130 1:144463270-144463292 TGCTTTTTTCTTGTTTCTTGAGG - Intergenic
914108369 1:144680350-144680372 TGTAGGTTTCCTCATTTTTGGGG + Intergenic
914590938 1:149105166-149105188 TGCTTTTTTCTTGTTTCTTGAGG - Intergenic
916552846 1:165865488-165865510 TGCTTTTTTCCCCATTTTTTAGG + Intronic
916832519 1:168507535-168507557 CTCTTGTTTCCTAGTTCTTGGGG + Intergenic
916845107 1:168642631-168642653 TGCTGTTTTCCTTATTCGTGTGG - Intergenic
917163022 1:172079734-172079756 TGTTTTTTTCCTCATCTTTGTGG + Intronic
917570757 1:176263015-176263037 TGTTGGTTACCTCAGTCTTGGGG + Intergenic
918175795 1:182043938-182043960 TGCTTGTTTCATCCTCCTTGTGG + Intergenic
918674667 1:187268085-187268107 TGTTTGTTTACTCATACTTCTGG + Intergenic
920742111 1:208590818-208590840 TGATTGTGTCCTCATTTTTGAGG - Intergenic
921082560 1:211754441-211754463 GGCTGTTTTCCTCATCCTTGTGG + Intronic
1064347901 10:14549146-14549168 TGTTGGTTTCCTCACACTTGTGG - Intronic
1064362757 10:14680659-14680681 TGTTTATTTCCCCATTCTTCTGG + Intronic
1064381975 10:14852154-14852176 TTCTTTTTTCCTCAGTCATGTGG - Intronic
1064448034 10:15413963-15413985 TCCTTCTTTCCTCACTCCTGTGG + Intergenic
1065491743 10:26289272-26289294 AGATTGTTTCCTCATTCCTGTGG - Intronic
1066318350 10:34272774-34272796 GGATTGTTTTCTCATTGTTGAGG - Intronic
1072871689 10:99126580-99126602 CTGTTGTTTCCTTATTCTTGGGG - Intronic
1074181397 10:111067993-111068015 TGTTTGTCTCATCATTCTGGAGG - Intergenic
1075763592 10:124875396-124875418 TACTTTTTTCCTCTTTCTTTTGG + Intergenic
1077772465 11:5234954-5234976 TGCTTGCTTCCTCCTTCTTTTGG + Intronic
1079146917 11:17860997-17861019 TGCTTGCTACCTGATTATTGTGG - Intronic
1079156368 11:17951812-17951834 TGCTGCTGTCCTCATTCTGGGGG - Intronic
1079560723 11:21815503-21815525 TGCTAGTTTCCTACTTCCTGTGG - Intergenic
1082946696 11:58769047-58769069 TGATTTTTTTCTCATTTTTGTGG - Intergenic
1082995243 11:59249010-59249032 TTCGAGTTTCCTCAATCTTGAGG - Intergenic
1085006684 11:73098115-73098137 TGCTCTTTTCCTAATTCTTAGGG + Intronic
1085136187 11:74090936-74090958 TCCTTGTGTCCTCATTCTTCAGG - Exonic
1086280598 11:85183041-85183063 CACTTGTTTCTTCATTCTGGAGG + Intronic
1088644759 11:111908973-111908995 TGCCTCTTTCCTCATTCTTTTGG - Intronic
1089348246 11:117805707-117805729 TGTTGGTTTACTCATTCTTTTGG + Intronic
1090798343 11:130154612-130154634 TGCATTTTTCCTTATTCATGTGG + Intergenic
1091763058 12:3100231-3100253 TGGTTCTTTTCTCAGTCTTGTGG + Intronic
1093119272 12:15248314-15248336 TGCCTGTTTTCTCATTGTTCTGG - Intronic
1094781075 12:33792374-33792396 TGCATGATTCCTCATTTATGAGG - Intergenic
1095735916 12:45555932-45555954 GTCTTGTTTGCTCCTTCTTGTGG - Intergenic
1096858541 12:54505171-54505193 TGCTTGTTTCCGCAATGTGGCGG - Intronic
1097251731 12:57637559-57637581 TTTTTGTTTCCTCATCTTTGAGG + Intergenic
1097680474 12:62644350-62644372 TGTTTGTTTCCTGAGTCCTGAGG - Exonic
1099357803 12:81660082-81660104 TGCTTTTTTCCCCATCTTTGTGG - Intronic
1102385536 12:112506179-112506201 TTTTTTTTTCCTCATTGTTGGGG + Exonic
1104493319 12:129213570-129213592 TGCTTGGTTCCTGATTCTGCTGG + Intronic
1106503854 13:30354879-30354901 AGCTTCCTTTCTCATTCTTGAGG - Intergenic
1108128415 13:47269990-47270012 AGCTTCTTCCCTCACTCTTGTGG - Intergenic
1108400788 13:50040109-50040131 TTCCTGTATCCTCAATCTTGAGG + Intergenic
1111335112 13:86810897-86810919 TGCTTGTCTCTTCAAACTTGGGG + Intergenic
1111483370 13:88862054-88862076 TGCTTGTTTGCTTGTTTTTGTGG + Intergenic
1113277546 13:108749412-108749434 TGTTTGTTTTCTTATTGTTGAGG - Intronic
1113527171 13:110989665-110989687 TGCTGTTTTGCTTATTCTTGTGG + Intergenic
1113713408 13:112486448-112486470 TGCTGTTTTGCTTATTCTTGTGG - Intronic
1114128525 14:19760467-19760489 GGGTTGTTTCCTCATTCTTTTGG + Intronic
1114171937 14:20281067-20281089 TGTTTTTTTCCTCATCTTTGTGG - Intronic
1115630050 14:35235765-35235787 GGCTAGTTTCCACATTCTTAAGG - Intronic
1116315509 14:43386160-43386182 TGTTTGTCTTCTTATTCTTGAGG - Intergenic
1116388642 14:44364300-44364322 TGCTTGAGTCCAGATTCTTGGGG + Intergenic
1117398196 14:55333051-55333073 TGCGTGTTTTCTCTTTCTAGTGG + Intronic
1118245961 14:64111005-64111027 TGCTTATTTCCTCATTAATTTGG + Intronic
1118643543 14:67816350-67816372 TGCTGAATTTCTCATTCTTGAGG - Intronic
1120608744 14:86612420-86612442 TGGTTGTTTCCACTTTTTTGGGG - Intergenic
1121067256 14:90979840-90979862 TGCTTCTTGCCTCAGTCTTTGGG - Intronic
1121813838 14:96914151-96914173 TGCTTGTTCCCTGATTCTAGAGG - Intronic
1123571468 15:21614735-21614757 GGGGTGTTTCCTCATTCTTTTGG + Intergenic
1123608087 15:22057326-22057348 GGGGTGTTTCCTCATTCTTTTGG + Intergenic
1124198346 15:27654396-27654418 TGCTTTTTTCCTCATCTTAGAGG + Intergenic
1125775806 15:42212592-42212614 TCCTAGCTTCCTCATTTTTGTGG + Intronic
1126364844 15:47883520-47883542 TGCTTATTTCTTCATTCTAGTGG + Intergenic
1126562734 15:50061309-50061331 TTCTTGCTTCCACATTCCTGTGG - Intronic
1127146991 15:56035055-56035077 GGCTTGTTTGGTCATTTTTGTGG - Intergenic
1131018354 15:89076312-89076334 CACTCGTATCCTCATTCTTGTGG + Intergenic
1131410284 15:92201593-92201615 GGCTTGTTGCCTCTTTCTTGTGG + Intergenic
1131453508 15:92565408-92565430 GGCTTGTTGCCTCTTTCTTGTGG - Intergenic
1131787867 15:95932463-95932485 CCCTTGTTTCCTCATTTTTCTGG + Intergenic
1131992804 15:98106983-98107005 TGCACGTTTTCTCACTCTTGTGG - Intergenic
1132098126 15:99003490-99003512 TGCACGTTTTCTCACTCTTGTGG + Intronic
1202980322 15_KI270727v1_random:349124-349146 GGGGTGTTTCCTCATTCTTTTGG + Intergenic
1135160064 16:20086309-20086331 CTCTTTTTTCCTCCTTCTTGAGG + Intergenic
1135675839 16:24414193-24414215 TGCTTGATTCTTCTTGCTTGGGG - Intergenic
1136601638 16:31295786-31295808 TGCCTTTTTCCTCATTTTAGTGG + Intronic
1137797208 16:51232080-51232102 TGTTTGTTTCATTTTTCTTGAGG + Intergenic
1139777867 16:69328416-69328438 TGGTTCTTGGCTCATTCTTGGGG - Exonic
1140382933 16:74506770-74506792 TGCATGTTTCTTCATTCTGCTGG + Intronic
1140602791 16:76498819-76498841 TGTTTGTTTCCACATACATGAGG + Intronic
1142181574 16:88673638-88673660 TGCTAGTTTTGTCCTTCTTGAGG - Intergenic
1142677991 17:1527088-1527110 TGCTTATTTCCTGTTTCCTGGGG + Intronic
1143357610 17:6342211-6342233 TGCTTGTTTCCTGCTTTCTGGGG - Intergenic
1144232836 17:13226170-13226192 TGTTTTTTTCCTCTTTCTGGAGG - Intergenic
1144891128 17:18494928-18494950 TGCTTGTTGGCACATTCATGTGG + Exonic
1145141096 17:20449390-20449412 TGCTTGTTGGCACATTCATGTGG - Intronic
1145370658 17:22303940-22303962 TGCTTCCTCTCTCATTCTTGAGG + Intergenic
1145794830 17:27649543-27649565 TGCTTGTTGGCACATTCATGTGG + Exonic
1145809325 17:27755262-27755284 TGCTTGTTGGCACATTCATGTGG + Intergenic
1149352087 17:55800737-55800759 TGTTTTTTTCCTCATCTTTGTGG + Intronic
1151138363 17:71969022-71969044 CGTTTGTTTCCTCATAGTTGTGG - Intergenic
1153147200 18:2046902-2046924 TGCTTGTGTCCTTTGTCTTGAGG + Intergenic
1153662221 18:7335059-7335081 TCCTTGTTGCCTCATGCCTGAGG + Intergenic
1156559299 18:38104270-38104292 TGCTTTTTTCTTCAGTCTTTTGG - Intergenic
1157159266 18:45298354-45298376 TGCTTGTTTCCCCTTTGATGCGG + Intronic
1159077436 18:63697402-63697424 TTCTTCTTTCCTCATTCTAATGG + Intronic
1161486811 19:4540254-4540276 TCCTTGCTTCCTGATTTTTGGGG + Exonic
1162789797 19:13056923-13056945 TGCTTGTTTCCTGGATCCTGGGG + Intronic
1164216309 19:23153001-23153023 TCTCTGTTTCATCATTCTTGGGG - Intergenic
1164414503 19:28035117-28035139 TGATTGCTTCCTCATTGGTGGGG + Intergenic
1164696784 19:30250926-30250948 TTATTGCTTCCTCATTTTTGAGG + Intronic
1167022649 19:46889648-46889670 CTCTTGTTTCCTGATTCATGTGG - Intergenic
925095678 2:1198503-1198525 TTCTTGTTTTCCCATTCTTTAGG - Intronic
927856622 2:26531654-26531676 TCATTGTCTCCTCATTTTTGTGG + Intronic
928417535 2:31108612-31108634 TGTTTTTATCCTCATTCTTTTGG - Intronic
929243375 2:39675662-39675684 TTCTTGTTTTCACATTCTTCTGG + Intronic
930735097 2:54770381-54770403 TCCATGGTTCCTCATTCCTGTGG + Intronic
930850835 2:55958554-55958576 TGCATGCTTCCTCATTCTTTAGG + Intergenic
931086609 2:58838251-58838273 TCCTTTTTTCTTCTTTCTTGTGG + Intergenic
934136688 2:89002408-89002430 TGCATGATTGCTCATTCCTGAGG - Intergenic
934181090 2:89621364-89621386 TGTAGGTTTCCTCATTTTTGGGG - Intergenic
934291388 2:91695605-91695627 TGTAGGTTTCCTCATTTTTGGGG - Intergenic
934864198 2:97791409-97791431 CTCTTGTTTGCTCATTCTGGGGG + Intronic
937145011 2:119637135-119637157 TGCTTGTTTCCACATTACTGTGG + Intronic
938923825 2:136020415-136020437 TCCTTTTTTCCACATTCCTGTGG - Intergenic
939670543 2:145006409-145006431 TGCTTTTATCCTCATTTTTTTGG + Intergenic
940052699 2:149480709-149480731 TGATTGTTTCCTCGTTGTTGGGG + Intergenic
940371671 2:152908754-152908776 AGCTTGTTTTCTCATTCTCTTGG + Intergenic
940698480 2:157011086-157011108 TGCATGATTCCTCATACATGAGG + Intergenic
940786662 2:157988923-157988945 TTCTGGTTGTCTCATTCTTGGGG + Intronic
941907316 2:170729390-170729412 TTCTTCTTTCCTCTTTCTTGAGG + Intergenic
942359331 2:175155572-175155594 TACTGATTTCTTCATTCTTGCGG - Intronic
943021761 2:182582870-182582892 TGCTTGTATCCTTATATTTGTGG + Intergenic
944831560 2:203538177-203538199 TGCTTGTTCCCTCCTTCTTCTGG - Intergenic
945918107 2:215726093-215726115 TTTTTTTTTCTTCATTCTTGTGG - Intergenic
946853439 2:223929995-223930017 TTCTTGTTTCCTTATTGTTTAGG - Intronic
946889356 2:224259406-224259428 GGCCTGCTTCATCATTCTTGTGG - Intergenic
947386273 2:229593742-229593764 TTCTTGTTGCATAATTCTTGGGG - Intronic
948297303 2:236871151-236871173 TTATTGGTTCCTCATTCTTTAGG - Intergenic
948501709 2:238398856-238398878 GGATTTTTTCTTCATTCTTGAGG - Exonic
1168842401 20:917744-917766 TGCTTGTTTCCTCAGAGTAGGGG + Intergenic
1173948518 20:46971320-46971342 AACTTGTTTCCTCATCCTTAAGG + Intronic
1175880177 20:62253441-62253463 AGATTGTCTCCTCTTTCTTGTGG + Intronic
1175882631 20:62269713-62269735 TGCTTTTCTGCTCATTCTTTCGG + Intronic
1176344963 21:5734912-5734934 AGCTTGTATCCTCAAACTTGTGG + Intergenic
1176351777 21:5855496-5855518 AGCTTGTATCCTCAAACTTGTGG + Intergenic
1176499864 21:7589543-7589565 AGCTTGTATCCTCAAACTTGTGG - Intergenic
1176539284 21:8132982-8133004 AGCTTGTATCCTCAAACTTGTGG + Intergenic
1176558235 21:8316027-8316049 AGCTTGTATCCTCAAACTTGTGG + Intergenic
1176885607 21:14251544-14251566 TGAGTGTTCTCTCATTCTTGGGG - Intergenic
1176937996 21:14888942-14888964 TGTTTGTTTCCTGATTCCTGTGG + Intergenic
1181861644 22:25823653-25823675 AGCTGGTTTCCTCATCCTCGAGG - Exonic
1182043306 22:27255055-27255077 TGCCTGTTTTCTCCTTCATGGGG - Intergenic
1184714732 22:46274497-46274519 TGCTGGTTCCCTCATTCTCCGGG + Intronic
1185001297 22:48248105-48248127 TGTTTGTGTCCTCCTGCTTGAGG + Intergenic
1203244233 22_KI270733v1_random:49337-49359 AGCTTGTATCCTCAAACTTGTGG + Intergenic
949742848 3:7256159-7256181 TACTTGTCTCCTTATTCTTCAGG + Intronic
949783213 3:7712920-7712942 TGCTTCTGTCTTCATTCATGTGG + Intronic
950319648 3:12038977-12038999 TGTTTTATTCCTCATTTTTGGGG + Intronic
950410022 3:12830194-12830216 TTCTTCTTTTCTCTTTCTTGGGG - Intronic
951208696 3:19950501-19950523 TGCTTGTTTCCTCATTTATAAGG + Intronic
951435745 3:22661631-22661653 TTATTTTTTCCTCATTCCTGAGG - Intergenic
952538472 3:34339518-34339540 TGGATAATTCCTCATTCTTGGGG + Intergenic
952563894 3:34632317-34632339 GGCTTGTTTTCTCATTCTCTTGG + Intergenic
953071552 3:39525760-39525782 TGCCTGATTCCTCTTTCTGGGGG - Intronic
953446317 3:42971196-42971218 TGCATGTTTGTTCATTCATGTGG - Intronic
953612289 3:44457179-44457201 TGTTTGTTTCTTCATACCTGGGG + Intronic
955060856 3:55490099-55490121 TGCTAGTTTCTCCATTCTTCGGG - Intergenic
955609822 3:60745082-60745104 TGCTTTTTTCCCCCTTTTTGTGG - Intronic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
956704745 3:71989635-71989657 TCTTTGTTCCCTTATTCTTGTGG + Intergenic
958255389 3:91319736-91319758 TGTTTTTTTCCTCATCTTTGTGG + Intergenic
958748615 3:98167443-98167465 TCATTGTTTCCTCACTCTAGAGG + Intergenic
959572383 3:107898952-107898974 AGCTTGTTTCCTCATTCATAAGG - Intergenic
960248493 3:115425981-115426003 TGCTTGTATTGTTATTCTTGTGG - Intergenic
961105588 3:124238281-124238303 TGCCTGTTCCCTCATTTCTGGGG - Intronic
963093537 3:141510488-141510510 TTTTGGTTCCCTCATTCTTGAGG - Intronic
965437843 3:168674613-168674635 TTATTGTTTCATCATTCTGGTGG + Intergenic
966078609 3:175970631-175970653 TTCTTGTTTCTTCATACTTCTGG - Intergenic
967219327 3:187235784-187235806 TGCTTGCTGCCGCATTCTTCAGG + Exonic
967943586 3:194784921-194784943 TGCTTCTTTCTTTTTTCTTGGGG + Intergenic
968743514 4:2344049-2344071 TGTTTGTTTCCTGTCTCTTGGGG - Intronic
969738692 4:9008721-9008743 TGTTTTTTTCCTTTTTCTTGAGG - Intergenic
970136201 4:12926995-12927017 TGCTTATTTCCTGATTCTTATGG + Intergenic
970261203 4:14226962-14226984 TGCTTGTTTCTTGATTCCAGTGG + Intergenic
971596204 4:28532331-28532353 AGCTTGTTTCGCCATTGTTGAGG + Intergenic
973166832 4:47088413-47088435 TGCTAGCTTTCTCATTCTTCAGG - Intronic
974227913 4:59072186-59072208 TGGTAGTTTCCTCATACTTGTGG + Intergenic
975550149 4:75604793-75604815 TGCTCTTTTCCTCTCTCTTGAGG + Intronic
975617841 4:76265268-76265290 TCCTTGCTTCCCCATTCTAGAGG + Intronic
979050111 4:115919930-115919952 TGCTTGCTTAATCATTCTTGTGG - Intergenic
979266295 4:118706925-118706947 TGTTTGTTTTCTTATTGTTGAGG + Intronic
979362393 4:119780201-119780223 GGATGGTTTCCTCATGCTTGGGG + Intergenic
979540361 4:121873918-121873940 AGCTACTTTCCTGATTCTTGTGG + Intergenic
979653510 4:123164023-123164045 GGCTTGTTTTCTTATTATTGAGG + Intronic
980745304 4:137004954-137004976 TACTTGTTTTTTCATACTTGGGG - Intergenic
981162615 4:141516890-141516912 TGCTTCTTAGCTCATTCATGTGG + Intergenic
981629826 4:146805264-146805286 TGGTTTTTTCCTCATCTTTGTGG - Intronic
982933868 4:161444788-161444810 AAGTTATTTCCTCATTCTTGGGG - Intronic
983665711 4:170179996-170180018 TGCTTCTTTTCTCATTTCTGTGG + Intergenic
984022422 4:174502320-174502342 TGTTTTTTTTCTCATTCTTATGG + Intronic
984885761 4:184447957-184447979 TGCTAGTTTCCTGATTCTGATGG + Intronic
985037416 4:185854741-185854763 TTCTTCATTCCTCTTTCTTGTGG - Intronic
985919289 5:2957016-2957038 TGTTAGTTTCCTCAGTCTTGGGG + Intergenic
986796030 5:11212878-11212900 TGTTTATTTCCTCATTTATGTGG - Intronic
986953518 5:13121347-13121369 TGATTGTTTCATTAGTCTTGGGG - Intergenic
988118580 5:26929057-26929079 TGCATTTTTTCTCATTCTTTAGG - Intronic
988892397 5:35631841-35631863 TGCATATTACTTCATTCTTGTGG - Intronic
989174925 5:38514986-38515008 CTCTTATTTCCTCATTTTTGTGG - Intronic
989301521 5:39899885-39899907 TGCTTGTTGCCTCAGTCTCTAGG + Intergenic
990116669 5:52399419-52399441 TGCTTGTTTCCTTATGGGTGAGG - Intergenic
990250467 5:53909071-53909093 TGTTTGTTTGCTCTGTCTTGAGG - Intronic
990846424 5:60145369-60145391 TCCTTGTTTCCTGATTGCTGGGG + Intronic
991978592 5:72208511-72208533 TGCATGCTTTCTCAGTCTTGTGG + Exonic
992898604 5:81270192-81270214 TGCTTGCTTCCTCAGTCGGGAGG + Intergenic
993427059 5:87778823-87778845 TGCTTGTTTTTTAATACTTGTGG + Intergenic
993889194 5:93452616-93452638 TGTTTCTTTCCTCAGCCTTGAGG - Intergenic
994015153 5:94956293-94956315 TGTTTTTTTCCTCATCTTTGTGG - Intronic
994946616 5:106401948-106401970 TGCTTCCTTCCTCATTATTTGGG + Intergenic
995169379 5:109089842-109089864 TGCTTGTTTCATCAGTGTTTGGG - Intronic
995380613 5:111528911-111528933 TGCCTGTTTCCTCATATTAGGGG - Intergenic
997065824 5:130557135-130557157 TTTTTGTTTCCTCAAGCTTGGGG - Intergenic
997811867 5:136978628-136978650 AACTTGTGTCCTCTTTCTTGTGG + Exonic
997858471 5:137394702-137394724 AGCTGGCTTTCTCATTCTTGTGG - Intronic
998253807 5:140569960-140569982 TTCTTGTCTCCTCATTCTGGAGG - Intronic
998900745 5:146850991-146851013 TGTTTATTTACTCATCCTTGGGG - Intronic
998939248 5:147262719-147262741 TGCCTGTCTCTTCATCCTTGTGG - Intronic
999496002 5:152097904-152097926 TGTTTGTTTCCTGATTCTGTTGG + Intergenic
999530364 5:152456357-152456379 TGCCTGTCATCTCATTCTTGGGG - Intergenic
1000904600 5:166949463-166949485 TGCTTGTTTTCTCATTCATCTGG - Intergenic
1001991254 5:176117398-176117420 TGCTTGATTCTCCTTTCTTGTGG + Intronic
1002225621 5:177720738-177720760 TGCTTGATTCTCCTTTCTTGTGG - Intronic
1002268228 5:178050467-178050489 TGCTTGATTCTCCTTTCTTGTGG + Intronic
1003177714 6:3765056-3765078 TTCTTGTTTCCTCCCTCCTGTGG + Intergenic
1003835792 6:10071098-10071120 TGGTTCCTTCCTCATTCTTGGGG - Intronic
1004265511 6:14145400-14145422 CACTTGTTCCCACATTCTTGTGG - Intergenic
1004859962 6:19793807-19793829 TGCTTGGTTTCCCATTTTTGTGG + Intergenic
1005471989 6:26170320-26170342 TGCTTGTTTCCTAATGCCTAAGG + Intronic
1005634202 6:27737980-27738002 TGCTTTTTTCCTGTCTCTTGTGG - Intergenic
1008075470 6:47140956-47140978 TCCTTGTCTCCACTTTCTTGAGG - Intergenic
1009484918 6:64208770-64208792 TGCTTTTTTCCTCATAATTATGG - Intronic
1010984526 6:82408380-82408402 TTCTTGTTTTCACATTCTTTTGG - Intergenic
1011492206 6:87903862-87903884 TGCTTTTTTTCTCATTTTGGTGG + Intergenic
1011689841 6:89857164-89857186 TACTTATTTCTTCATCCTTGCGG - Exonic
1013549523 6:111193422-111193444 CACTTGTTTACTCATTCATGGGG + Intronic
1013920362 6:115396038-115396060 TGATTTTTTTCTCATCCTTGTGG + Intergenic
1014028324 6:116673855-116673877 TGCTTCTTCCCTCATTTTGGTGG - Intergenic
1015049589 6:128823404-128823426 TGCTTTCTTCCTCATCTTTGAGG - Intergenic
1016008618 6:139115022-139115044 TGATTGTTTCCTCATTTCTATGG - Intergenic
1017252741 6:152299085-152299107 TGCATGTTTCATCATTTTTAGGG + Intronic
1019881920 7:3869097-3869119 TGTTAGTTTCCTCTTTTTTGGGG - Intronic
1020574681 7:9912205-9912227 TACTTGTGTCCTGATGCTTGTGG + Intergenic
1020598225 7:10239266-10239288 TGCTTGTTCCTGCTTTCTTGTGG - Intergenic
1021967308 7:25933121-25933143 TGGTTCTTTCCTCATCTTTGTGG - Intergenic
1023672549 7:42593142-42593164 TGTTCATTTCCTCAATCTTGAGG + Intergenic
1027537238 7:79418793-79418815 TGCTTTTTTTTTCATTGTTGGGG - Intronic
1027693764 7:81382172-81382194 TGTCTGTTTCCTCTTTCTAGGGG - Intergenic
1027724255 7:81783646-81783668 TGATTTTTTCCTAATTATTGTGG - Intergenic
1027755984 7:82212799-82212821 TACTTGTTTCATCATTTATGAGG - Intronic
1028734215 7:94189138-94189160 TGCTTCTTTCCTCATCTTTGTGG + Intergenic
1029004053 7:97188585-97188607 TGCTTGTTTACTGAAACTTGAGG - Intergenic
1029812965 7:103067848-103067870 TCCTTGGTTCATCATTATTGTGG - Intronic
1030730791 7:112986058-112986080 TGCTTGGTTCCTTAATCTAGTGG + Intergenic
1032288267 7:130560849-130560871 TACTTGTTTTCTCATGCTTTAGG - Intronic
1032863615 7:135904571-135904593 TGCTCGTTTCCTTTCTCTTGTGG - Intergenic
1033891508 7:146018673-146018695 TGTTTTTTTCCTCATCTTTGTGG + Intergenic
1034323035 7:150203302-150203324 TGCTTGTGTGCTCATGCTTATGG - Intergenic
1034598191 7:152219671-152219693 TGTTGGTTTGCTCATTTTTGGGG - Intronic
1034770145 7:153765805-153765827 TGCTTGTGTACTCATGCTTATGG + Intergenic
1034857184 7:154562519-154562541 TGCTTTTTTCCCTAATCTTGAGG - Intronic
1035849782 8:2905671-2905693 TGTTTGTTTCATCGTTTTTGTGG + Intergenic
1036594454 8:10199758-10199780 TCCTTATTTCCTCACTCTTTGGG + Intronic
1037556206 8:20025642-20025664 TGTTTTTTACCTCATTATTGTGG - Intergenic
1039433577 8:37544682-37544704 TCCTTTTTTCCTTCTTCTTGAGG + Intergenic
1040725383 8:50376443-50376465 TGCCTATTACCTCATCCTTGAGG + Intronic
1040902685 8:52432932-52432954 TGCTATTTTCCTCATTGTTCTGG - Intronic
1041885908 8:62807438-62807460 TTCTTGTTTCCTACTTTTTGTGG + Intronic
1042024505 8:64408368-64408390 TCCTATTTTCCTCATCCTTGGGG + Intergenic
1042418178 8:68551517-68551539 TTCTTGTTTCCTCTCTCTTCAGG + Intronic
1042949587 8:74187117-74187139 TGGCTGTTTCCTAAGTCTTGGGG + Intergenic
1044947956 8:97408337-97408359 TGCTTGCTTCCTCAATGTGGAGG - Intergenic
1045620405 8:103970707-103970729 TGCCTGTCTCTTCAATCTTGGGG + Intronic
1045841002 8:106580961-106580983 TGCTTGTTTCCTCATTCTTGTGG + Intronic
1046159511 8:110342034-110342056 TTCTTGTTTCTTGATACTTGAGG - Intergenic
1046902300 8:119536475-119536497 AGCATGTTCCCTCTTTCTTGAGG + Intergenic
1048125212 8:131627142-131627164 TTCTTGTCTCTTCATTCTTATGG + Intergenic
1050777287 9:9281294-9281316 GGCTTGTCTTCTCATTCTTTTGG - Intronic
1051934061 9:22422843-22422865 TGCCTGTTTCTTCAATTTTGGGG + Intergenic
1055260273 9:74425170-74425192 TGTTTTTTTCCTCATCTTTGTGG - Intergenic
1056989035 9:91392613-91392635 TGTTTGCTTCCTCATCTTTGTGG + Intergenic
1059315441 9:113421698-113421720 TTCTTCTTTCCTGATCCTTGAGG + Intronic
1059710199 9:116860749-116860771 AGCCTGTTTCCACATTCCTGAGG + Intronic
1061653778 9:132071884-132071906 TGCTTGTGTGCTCATCCATGGGG - Intronic
1203460565 Un_GL000220v1:32424-32446 AGCTTGTATCCTCAAACTTGCGG + Intergenic
1186316841 X:8379823-8379845 TCATTGTTTCCTCATTTTTTGGG + Intergenic
1186504728 X:10082104-10082126 TGCTGGTTTTGTCATTCATGCGG + Intronic
1186883090 X:13885803-13885825 TGCTTCTCCGCTCATTCTTGCGG - Intronic
1187279009 X:17842418-17842440 TGCTAGGTTCCACATGCTTGGGG + Intronic
1189720079 X:43906867-43906889 TGCTTTCTTACTCATTCTTTGGG + Intergenic
1190125322 X:47699619-47699641 TGCTTGTTCCTATATTCTTGGGG - Intergenic
1191154869 X:57263031-57263053 TGCCTGTTTCCTAATTTTAGGGG - Intergenic
1192670977 X:73140960-73140982 TGCTTGTTTCTTCACAATTGTGG + Intergenic
1192927850 X:75775716-75775738 TGCTTTTTTTCTCATTTTTGTGG + Intergenic
1193982767 X:88204609-88204631 TGTATGTTTCCACATTCATGAGG - Intergenic
1194245916 X:91511641-91511663 TGCTTTTTTCCCCATCTTTGTGG - Intergenic
1195018874 X:100806092-100806114 TGCTTCTTTCAAGATTCTTGAGG - Intergenic
1195733610 X:107991176-107991198 TGCTTTTTTCCCCATCTTTGTGG + Intergenic
1197220105 X:123904098-123904120 TGTTTGTTTCTTCCTTTTTGTGG + Intronic
1197374473 X:125664661-125664683 TGCTTGTTTTCTCATCTGTGTGG - Intergenic
1197526165 X:127566293-127566315 GGCTTTTTTCCTCATTCTGTTGG + Intergenic
1198510408 X:137344755-137344777 TACCTTTTTCCTCAATCTTGGGG - Intergenic
1199589168 X:149450647-149450669 TGTTTTTTTTCTCATTTTTGTGG + Intergenic