ID: 1045842615

View in Genome Browser
Species Human (GRCh38)
Location 8:106597347-106597369
Sequence AGGCTCCTTCCAGAACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045842611_1045842615 27 Left 1045842611 8:106597297-106597319 CCGTCACTCCTGTGAAGTTAGAG 0: 1
1: 0
2: 1
3: 19
4: 157
Right 1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG No data
1045842610_1045842615 28 Left 1045842610 8:106597296-106597318 CCCGTCACTCCTGTGAAGTTAGA 0: 1
1: 0
2: 2
3: 10
4: 124
Right 1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG No data
1045842609_1045842615 29 Left 1045842609 8:106597295-106597317 CCCCGTCACTCCTGTGAAGTTAG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG No data
1045842612_1045842615 19 Left 1045842612 8:106597305-106597327 CCTGTGAAGTTAGAGTGAGATGA 0: 1
1: 0
2: 3
3: 21
4: 189
Right 1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG No data
1045842614_1045842615 -10 Left 1045842614 8:106597334-106597356 CCTGTGAGAAAGCAGGCTCCTTC 0: 1
1: 0
2: 2
3: 13
4: 191
Right 1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045842615 Original CRISPR AGGCTCCTTCCAGAACCTGC AGG Intronic
No off target data available for this crispr