ID: 1045848096

View in Genome Browser
Species Human (GRCh38)
Location 8:106660624-106660646
Sequence ACGCATCAAGAAGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045848085_1045848096 19 Left 1045848085 8:106660582-106660604 CCTTGTTTCTGTTCCTTCTCACA 0: 1
1: 1
2: 6
3: 79
4: 663
Right 1045848096 8:106660624-106660646 ACGCATCAAGAAGGGGTGGAGGG No data
1045848090_1045848096 -6 Left 1045848090 8:106660607-106660629 CCAACATCGGAGGAGTTACGCAT 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1045848096 8:106660624-106660646 ACGCATCAAGAAGGGGTGGAGGG No data
1045848087_1045848096 6 Left 1045848087 8:106660595-106660617 CCTTCTCACAACCCAACATCGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1045848096 8:106660624-106660646 ACGCATCAAGAAGGGGTGGAGGG No data
1045848089_1045848096 -5 Left 1045848089 8:106660606-106660628 CCCAACATCGGAGGAGTTACGCA 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1045848096 8:106660624-106660646 ACGCATCAAGAAGGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045848096 Original CRISPR ACGCATCAAGAAGGGGTGGA GGG Intronic
No off target data available for this crispr