ID: 1045849198

View in Genome Browser
Species Human (GRCh38)
Location 8:106673177-106673199
Sequence CAAAATGCTGATAGTGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045849196_1045849198 4 Left 1045849196 8:106673150-106673172 CCTAGAAACTTGTCGAATGGCTT 0: 3
1: 83
2: 1645
3: 1946
4: 1407
Right 1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045849198 Original CRISPR CAAAATGCTGATAGTGATAA TGG Intronic
No off target data available for this crispr