ID: 1045860500

View in Genome Browser
Species Human (GRCh38)
Location 8:106811032-106811054
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045860500_1045860510 23 Left 1045860500 8:106811032-106811054 CCAACCTCCCTCTCCAGGTGAGG No data
Right 1045860510 8:106811078-106811100 TAGGTGGGTGCTCCCCACTGAGG No data
1045860500_1045860509 8 Left 1045860500 8:106811032-106811054 CCAACCTCCCTCTCCAGGTGAGG No data
Right 1045860509 8:106811063-106811085 TGAGAACAATGCTGATAGGTGGG No data
1045860500_1045860506 4 Left 1045860500 8:106811032-106811054 CCAACCTCCCTCTCCAGGTGAGG No data
Right 1045860506 8:106811059-106811081 GCCTTGAGAACAATGCTGATAGG No data
1045860500_1045860508 7 Left 1045860500 8:106811032-106811054 CCAACCTCCCTCTCCAGGTGAGG No data
Right 1045860508 8:106811062-106811084 TTGAGAACAATGCTGATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045860500 Original CRISPR CCTCACCTGGAGAGGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr