ID: 1045860503

View in Genome Browser
Species Human (GRCh38)
Location 8:106811039-106811061
Sequence GGCATAGCCTCACCTGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045860503_1045860510 16 Left 1045860503 8:106811039-106811061 CCCTCTCCAGGTGAGGCTATGCC No data
Right 1045860510 8:106811078-106811100 TAGGTGGGTGCTCCCCACTGAGG No data
1045860503_1045860508 0 Left 1045860503 8:106811039-106811061 CCCTCTCCAGGTGAGGCTATGCC No data
Right 1045860508 8:106811062-106811084 TTGAGAACAATGCTGATAGGTGG No data
1045860503_1045860509 1 Left 1045860503 8:106811039-106811061 CCCTCTCCAGGTGAGGCTATGCC No data
Right 1045860509 8:106811063-106811085 TGAGAACAATGCTGATAGGTGGG No data
1045860503_1045860506 -3 Left 1045860503 8:106811039-106811061 CCCTCTCCAGGTGAGGCTATGCC No data
Right 1045860506 8:106811059-106811081 GCCTTGAGAACAATGCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045860503 Original CRISPR GGCATAGCCTCACCTGGAGA GGG (reversed) Intergenic
No off target data available for this crispr