ID: 1045860504

View in Genome Browser
Species Human (GRCh38)
Location 8:106811040-106811062
Sequence AGGCATAGCCTCACCTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045860504_1045860506 -4 Left 1045860504 8:106811040-106811062 CCTCTCCAGGTGAGGCTATGCCT No data
Right 1045860506 8:106811059-106811081 GCCTTGAGAACAATGCTGATAGG No data
1045860504_1045860510 15 Left 1045860504 8:106811040-106811062 CCTCTCCAGGTGAGGCTATGCCT No data
Right 1045860510 8:106811078-106811100 TAGGTGGGTGCTCCCCACTGAGG No data
1045860504_1045860509 0 Left 1045860504 8:106811040-106811062 CCTCTCCAGGTGAGGCTATGCCT No data
Right 1045860509 8:106811063-106811085 TGAGAACAATGCTGATAGGTGGG No data
1045860504_1045860508 -1 Left 1045860504 8:106811040-106811062 CCTCTCCAGGTGAGGCTATGCCT No data
Right 1045860508 8:106811062-106811084 TTGAGAACAATGCTGATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045860504 Original CRISPR AGGCATAGCCTCACCTGGAG AGG (reversed) Intergenic
No off target data available for this crispr