ID: 1045860508

View in Genome Browser
Species Human (GRCh38)
Location 8:106811062-106811084
Sequence TTGAGAACAATGCTGATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045860500_1045860508 7 Left 1045860500 8:106811032-106811054 CCAACCTCCCTCTCCAGGTGAGG No data
Right 1045860508 8:106811062-106811084 TTGAGAACAATGCTGATAGGTGG No data
1045860505_1045860508 -6 Left 1045860505 8:106811045-106811067 CCAGGTGAGGCTATGCCTTGAGA No data
Right 1045860508 8:106811062-106811084 TTGAGAACAATGCTGATAGGTGG No data
1045860503_1045860508 0 Left 1045860503 8:106811039-106811061 CCCTCTCCAGGTGAGGCTATGCC No data
Right 1045860508 8:106811062-106811084 TTGAGAACAATGCTGATAGGTGG No data
1045860498_1045860508 12 Left 1045860498 8:106811027-106811049 CCTCACCAACCTCCCTCTCCAGG No data
Right 1045860508 8:106811062-106811084 TTGAGAACAATGCTGATAGGTGG No data
1045860502_1045860508 3 Left 1045860502 8:106811036-106811058 CCTCCCTCTCCAGGTGAGGCTAT No data
Right 1045860508 8:106811062-106811084 TTGAGAACAATGCTGATAGGTGG No data
1045860504_1045860508 -1 Left 1045860504 8:106811040-106811062 CCTCTCCAGGTGAGGCTATGCCT No data
Right 1045860508 8:106811062-106811084 TTGAGAACAATGCTGATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045860508 Original CRISPR TTGAGAACAATGCTGATAGG TGG Intergenic
No off target data available for this crispr