ID: 1045860510

View in Genome Browser
Species Human (GRCh38)
Location 8:106811078-106811100
Sequence TAGGTGGGTGCTCCCCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045860502_1045860510 19 Left 1045860502 8:106811036-106811058 CCTCCCTCTCCAGGTGAGGCTAT No data
Right 1045860510 8:106811078-106811100 TAGGTGGGTGCTCCCCACTGAGG No data
1045860504_1045860510 15 Left 1045860504 8:106811040-106811062 CCTCTCCAGGTGAGGCTATGCCT No data
Right 1045860510 8:106811078-106811100 TAGGTGGGTGCTCCCCACTGAGG No data
1045860505_1045860510 10 Left 1045860505 8:106811045-106811067 CCAGGTGAGGCTATGCCTTGAGA No data
Right 1045860510 8:106811078-106811100 TAGGTGGGTGCTCCCCACTGAGG No data
1045860507_1045860510 -5 Left 1045860507 8:106811060-106811082 CCTTGAGAACAATGCTGATAGGT No data
Right 1045860510 8:106811078-106811100 TAGGTGGGTGCTCCCCACTGAGG No data
1045860503_1045860510 16 Left 1045860503 8:106811039-106811061 CCCTCTCCAGGTGAGGCTATGCC No data
Right 1045860510 8:106811078-106811100 TAGGTGGGTGCTCCCCACTGAGG No data
1045860498_1045860510 28 Left 1045860498 8:106811027-106811049 CCTCACCAACCTCCCTCTCCAGG No data
Right 1045860510 8:106811078-106811100 TAGGTGGGTGCTCCCCACTGAGG No data
1045860500_1045860510 23 Left 1045860500 8:106811032-106811054 CCAACCTCCCTCTCCAGGTGAGG No data
Right 1045860510 8:106811078-106811100 TAGGTGGGTGCTCCCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045860510 Original CRISPR TAGGTGGGTGCTCCCCACTG AGG Intergenic
No off target data available for this crispr