ID: 1045860567

View in Genome Browser
Species Human (GRCh38)
Location 8:106811407-106811429
Sequence AGCCTGTTATAGTGGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045860567_1045860571 -2 Left 1045860567 8:106811407-106811429 CCTAGTTCCCACTATAACAGGCT No data
Right 1045860571 8:106811428-106811450 CTTAATGTGGCTACACCACATGG No data
1045860567_1045860575 16 Left 1045860567 8:106811407-106811429 CCTAGTTCCCACTATAACAGGCT No data
Right 1045860575 8:106811446-106811468 CATGGTTACCAAAGGGAAGAAGG No data
1045860567_1045860572 8 Left 1045860567 8:106811407-106811429 CCTAGTTCCCACTATAACAGGCT No data
Right 1045860572 8:106811438-106811460 CTACACCACATGGTTACCAAAGG No data
1045860567_1045860573 9 Left 1045860567 8:106811407-106811429 CCTAGTTCCCACTATAACAGGCT No data
Right 1045860573 8:106811439-106811461 TACACCACATGGTTACCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045860567 Original CRISPR AGCCTGTTATAGTGGGAACT AGG (reversed) Intergenic
No off target data available for this crispr