ID: 1045860575

View in Genome Browser
Species Human (GRCh38)
Location 8:106811446-106811468
Sequence CATGGTTACCAAAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045860567_1045860575 16 Left 1045860567 8:106811407-106811429 CCTAGTTCCCACTATAACAGGCT No data
Right 1045860575 8:106811446-106811468 CATGGTTACCAAAGGGAAGAAGG No data
1045860568_1045860575 9 Left 1045860568 8:106811414-106811436 CCCACTATAACAGGCTTAATGTG No data
Right 1045860575 8:106811446-106811468 CATGGTTACCAAAGGGAAGAAGG No data
1045860569_1045860575 8 Left 1045860569 8:106811415-106811437 CCACTATAACAGGCTTAATGTGG No data
Right 1045860575 8:106811446-106811468 CATGGTTACCAAAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045860575 Original CRISPR CATGGTTACCAAAGGGAAGA AGG Intergenic
No off target data available for this crispr