ID: 1045872096 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:106938957-106938979 |
| Sequence | CTAAATACACAAAAGGAGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1045872096_1045872101 | 7 | Left | 1045872096 | 8:106938957-106938979 | CCCAGCTCCTTTTGTGTATTTAG | No data | ||
| Right | 1045872101 | 8:106938987-106939009 | AGGGTTTCACCATGTTAGCCAGG | 0: 5092 1: 58703 2: 171190 3: 192556 4: 152510 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1045872096 | Original CRISPR | CTAAATACACAAAAGGAGCT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||