ID: 1045872096

View in Genome Browser
Species Human (GRCh38)
Location 8:106938957-106938979
Sequence CTAAATACACAAAAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045872096_1045872101 7 Left 1045872096 8:106938957-106938979 CCCAGCTCCTTTTGTGTATTTAG No data
Right 1045872101 8:106938987-106939009 AGGGTTTCACCATGTTAGCCAGG 0: 5092
1: 58703
2: 171190
3: 192556
4: 152510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045872096 Original CRISPR CTAAATACACAAAAGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr