ID: 1045872199

View in Genome Browser
Species Human (GRCh38)
Location 8:106939754-106939776
Sequence ATGTGTCGGTGGCTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045872187_1045872199 24 Left 1045872187 8:106939707-106939729 CCTCTTCTCCTTCCCAGATTGAT No data
Right 1045872199 8:106939754-106939776 ATGTGTCGGTGGCTGGTGGAGGG No data
1045872190_1045872199 11 Left 1045872190 8:106939720-106939742 CCAGATTGATGACGAAGTCTTAG No data
Right 1045872199 8:106939754-106939776 ATGTGTCGGTGGCTGGTGGAGGG No data
1045872188_1045872199 16 Left 1045872188 8:106939715-106939737 CCTTCCCAGATTGATGACGAAGT No data
Right 1045872199 8:106939754-106939776 ATGTGTCGGTGGCTGGTGGAGGG No data
1045872189_1045872199 12 Left 1045872189 8:106939719-106939741 CCCAGATTGATGACGAAGTCTTA No data
Right 1045872199 8:106939754-106939776 ATGTGTCGGTGGCTGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045872199 Original CRISPR ATGTGTCGGTGGCTGGTGGA GGG Intergenic
No off target data available for this crispr