ID: 1045872426

View in Genome Browser
Species Human (GRCh38)
Location 8:106941702-106941724
Sequence ACCTTCTCCCAGCTAAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045872424_1045872426 26 Left 1045872424 8:106941653-106941675 CCAAGCTGTGAATGAACACTTCT No data
Right 1045872426 8:106941702-106941724 ACCTTCTCCCAGCTAAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045872426 Original CRISPR ACCTTCTCCCAGCTAAGGTC TGG Intergenic
No off target data available for this crispr