ID: 1045876369

View in Genome Browser
Species Human (GRCh38)
Location 8:106985828-106985850
Sequence ATCAGGACTTTGTAGTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045876369_1045876373 9 Left 1045876369 8:106985828-106985850 CCAAAGAACTACAAAGTCCTGAT No data
Right 1045876373 8:106985860-106985882 CTTTTGTTTTTTCAAGTAGGAGG No data
1045876369_1045876372 6 Left 1045876369 8:106985828-106985850 CCAAAGAACTACAAAGTCCTGAT No data
Right 1045876372 8:106985857-106985879 ATACTTTTGTTTTTTCAAGTAGG No data
1045876369_1045876374 10 Left 1045876369 8:106985828-106985850 CCAAAGAACTACAAAGTCCTGAT No data
Right 1045876374 8:106985861-106985883 TTTTGTTTTTTCAAGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045876369 Original CRISPR ATCAGGACTTTGTAGTTCTT TGG (reversed) Intergenic
No off target data available for this crispr