ID: 1045884933

View in Genome Browser
Species Human (GRCh38)
Location 8:107084447-107084469
Sequence GTGGATGTGGGCCAGAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045884928_1045884933 30 Left 1045884928 8:107084394-107084416 CCTGGGAGACAGAGTGAGACTCC 0: 960
1: 22474
2: 85139
3: 135038
4: 155386
Right 1045884933 8:107084447-107084469 GTGGATGTGGGCCAGAGTGTAGG No data
1045884929_1045884933 9 Left 1045884929 8:107084415-107084437 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1045884933 8:107084447-107084469 GTGGATGTGGGCCAGAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045884933 Original CRISPR GTGGATGTGGGCCAGAGTGT AGG Intergenic
No off target data available for this crispr