ID: 1045886891

View in Genome Browser
Species Human (GRCh38)
Location 8:107108703-107108725
Sequence CAGGGAGACCCAGCGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045886891_1045886904 20 Left 1045886891 8:107108703-107108725 CCACCTTCCGCTGGGTCTCCCTG No data
Right 1045886904 8:107108746-107108768 CCTCTTGGCTCCTACGTGAGAGG No data
1045886891_1045886894 -10 Left 1045886891 8:107108703-107108725 CCACCTTCCGCTGGGTCTCCCTG No data
Right 1045886894 8:107108716-107108738 GGTCTCCCTGTCATCCCTCCAGG No data
1045886891_1045886899 5 Left 1045886891 8:107108703-107108725 CCACCTTCCGCTGGGTCTCCCTG No data
Right 1045886899 8:107108731-107108753 CCTCCAGGCACCTGCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045886891 Original CRISPR CAGGGAGACCCAGCGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr