ID: 1045890313

View in Genome Browser
Species Human (GRCh38)
Location 8:107148230-107148252
Sequence TGTGCGCAGGAACACGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045890308_1045890313 0 Left 1045890308 8:107148207-107148229 CCCAGATCACAGTCTACTGACTC No data
Right 1045890313 8:107148230-107148252 TGTGCGCAGGAACACGGTGAGGG No data
1045890309_1045890313 -1 Left 1045890309 8:107148208-107148230 CCAGATCACAGTCTACTGACTCT No data
Right 1045890313 8:107148230-107148252 TGTGCGCAGGAACACGGTGAGGG No data
1045890306_1045890313 28 Left 1045890306 8:107148179-107148201 CCAGGGAGAAAGTATCTCATTTT No data
Right 1045890313 8:107148230-107148252 TGTGCGCAGGAACACGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045890313 Original CRISPR TGTGCGCAGGAACACGGTGA GGG Intergenic
No off target data available for this crispr