ID: 1045892534

View in Genome Browser
Species Human (GRCh38)
Location 8:107174282-107174304
Sequence CAGGGTCATTTCCAGTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045892534_1045892540 -4 Left 1045892534 8:107174282-107174304 CCAACCCACTGGAAATGACCCTG No data
Right 1045892540 8:107174301-107174323 CCTGAGCATAGCTCCTTGGTAGG No data
1045892534_1045892541 -3 Left 1045892534 8:107174282-107174304 CCAACCCACTGGAAATGACCCTG No data
Right 1045892541 8:107174302-107174324 CTGAGCATAGCTCCTTGGTAGGG No data
1045892534_1045892537 -8 Left 1045892534 8:107174282-107174304 CCAACCCACTGGAAATGACCCTG No data
Right 1045892537 8:107174297-107174319 TGACCCTGAGCATAGCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045892534 Original CRISPR CAGGGTCATTTCCAGTGGGT TGG (reversed) Intergenic
No off target data available for this crispr