ID: 1045894883

View in Genome Browser
Species Human (GRCh38)
Location 8:107202892-107202914
Sequence TTGCCTCTGCCAGAGATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045894883_1045894884 1 Left 1045894883 8:107202892-107202914 CCACAGATCTCTGGCAGAGGCAA No data
Right 1045894884 8:107202916-107202938 ATGCCACCAGTCTCTTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045894883 Original CRISPR TTGCCTCTGCCAGAGATCTG TGG (reversed) Intergenic
No off target data available for this crispr