ID: 1045897970

View in Genome Browser
Species Human (GRCh38)
Location 8:107240967-107240989
Sequence CAGCGAGACTACGTGGGCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045897970_1045897978 30 Left 1045897970 8:107240967-107240989 CCGACGCCCACGTAGTCTCGCTG No data
Right 1045897978 8:107241020-107241042 GCAAGGCGGCAGCGAGGCTGGGG 0: 1061
1: 2132
2: 1737
3: 742
4: 656
1045897970_1045897975 24 Left 1045897970 8:107240967-107240989 CCGACGCCCACGTAGTCTCGCTG No data
Right 1045897975 8:107241014-107241036 CAAACTGCAAGGCGGCAGCGAGG 0: 1083
1: 2030
2: 1615
3: 820
4: 595
1045897970_1045897974 16 Left 1045897970 8:107240967-107240989 CCGACGCCCACGTAGTCTCGCTG No data
Right 1045897974 8:107241006-107241028 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360
1045897970_1045897976 28 Left 1045897970 8:107240967-107240989 CCGACGCCCACGTAGTCTCGCTG No data
Right 1045897976 8:107241018-107241040 CTGCAAGGCGGCAGCGAGGCTGG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
1045897970_1045897973 13 Left 1045897970 8:107240967-107240989 CCGACGCCCACGTAGTCTCGCTG No data
Right 1045897973 8:107241003-107241025 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588
1045897970_1045897977 29 Left 1045897970 8:107240967-107240989 CCGACGCCCACGTAGTCTCGCTG No data
Right 1045897977 8:107241019-107241041 TGCAAGGCGGCAGCGAGGCTGGG 0: 1085
1: 2164
2: 1733
3: 667
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045897970 Original CRISPR CAGCGAGACTACGTGGGCGT CGG (reversed) Intergenic
No off target data available for this crispr