ID: 1045897974

View in Genome Browser
Species Human (GRCh38)
Location 8:107241006-107241028
Sequence TCTGAGATCAAACTGCAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4985
Summary {0: 2869, 1: 1007, 2: 456, 3: 293, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045897970_1045897974 16 Left 1045897970 8:107240967-107240989 CCGACGCCCACGTAGTCTCGCTG No data
Right 1045897974 8:107241006-107241028 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360
1045897972_1045897974 9 Left 1045897972 8:107240974-107240996 CCACGTAGTCTCGCTGATTGCTA No data
Right 1045897974 8:107241006-107241028 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360
1045897971_1045897974 10 Left 1045897971 8:107240973-107240995 CCCACGTAGTCTCGCTGATTGCT No data
Right 1045897974 8:107241006-107241028 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045897974 Original CRISPR TCTGAGATCAAACTGCAAGG CGG Intergenic
Too many off-targets to display for this crispr