ID: 1045897975

View in Genome Browser
Species Human (GRCh38)
Location 8:107241014-107241036
Sequence CAAACTGCAAGGCGGCAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6143
Summary {0: 1083, 1: 2030, 2: 1615, 3: 820, 4: 595}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045897972_1045897975 17 Left 1045897972 8:107240974-107240996 CCACGTAGTCTCGCTGATTGCTA No data
Right 1045897975 8:107241014-107241036 CAAACTGCAAGGCGGCAGCGAGG 0: 1083
1: 2030
2: 1615
3: 820
4: 595
1045897970_1045897975 24 Left 1045897970 8:107240967-107240989 CCGACGCCCACGTAGTCTCGCTG No data
Right 1045897975 8:107241014-107241036 CAAACTGCAAGGCGGCAGCGAGG 0: 1083
1: 2030
2: 1615
3: 820
4: 595
1045897971_1045897975 18 Left 1045897971 8:107240973-107240995 CCCACGTAGTCTCGCTGATTGCT No data
Right 1045897975 8:107241014-107241036 CAAACTGCAAGGCGGCAGCGAGG 0: 1083
1: 2030
2: 1615
3: 820
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045897975 Original CRISPR CAAACTGCAAGGCGGCAGCG AGG Intergenic
Too many off-targets to display for this crispr