ID: 1045897976

View in Genome Browser
Species Human (GRCh38)
Location 8:107241018-107241040
Sequence CTGCAAGGCGGCAGCGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6148
Summary {0: 1065, 1: 2097, 2: 1670, 3: 692, 4: 624}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045897972_1045897976 21 Left 1045897972 8:107240974-107240996 CCACGTAGTCTCGCTGATTGCTA No data
Right 1045897976 8:107241018-107241040 CTGCAAGGCGGCAGCGAGGCTGG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
1045897971_1045897976 22 Left 1045897971 8:107240973-107240995 CCCACGTAGTCTCGCTGATTGCT No data
Right 1045897976 8:107241018-107241040 CTGCAAGGCGGCAGCGAGGCTGG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
1045897970_1045897976 28 Left 1045897970 8:107240967-107240989 CCGACGCCCACGTAGTCTCGCTG No data
Right 1045897976 8:107241018-107241040 CTGCAAGGCGGCAGCGAGGCTGG 0: 1065
1: 2097
2: 1670
3: 692
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045897976 Original CRISPR CTGCAAGGCGGCAGCGAGGC TGG Intergenic
Too many off-targets to display for this crispr