ID: 1045897977

View in Genome Browser
Species Human (GRCh38)
Location 8:107241019-107241041
Sequence TGCAAGGCGGCAGCGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6159
Summary {0: 1085, 1: 2164, 2: 1733, 3: 667, 4: 510}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045897970_1045897977 29 Left 1045897970 8:107240967-107240989 CCGACGCCCACGTAGTCTCGCTG No data
Right 1045897977 8:107241019-107241041 TGCAAGGCGGCAGCGAGGCTGGG 0: 1085
1: 2164
2: 1733
3: 667
4: 510
1045897971_1045897977 23 Left 1045897971 8:107240973-107240995 CCCACGTAGTCTCGCTGATTGCT No data
Right 1045897977 8:107241019-107241041 TGCAAGGCGGCAGCGAGGCTGGG 0: 1085
1: 2164
2: 1733
3: 667
4: 510
1045897972_1045897977 22 Left 1045897972 8:107240974-107240996 CCACGTAGTCTCGCTGATTGCTA No data
Right 1045897977 8:107241019-107241041 TGCAAGGCGGCAGCGAGGCTGGG 0: 1085
1: 2164
2: 1733
3: 667
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045897977 Original CRISPR TGCAAGGCGGCAGCGAGGCT GGG Intergenic
Too many off-targets to display for this crispr